z-logo
open-access-imgOpen Access
First Report of ‘ Candidatus Liberibacter asiaticus’ associated with huanglongbing in the weeds Cleome rutidosperma, Pisonia aculeata and Trichostigma octandrum in Jamaica
Author(s) -
Brown S.E.,
Oberheim A.P,
Barrett A.,
McLaughlin W.A.
Publication year - 2011
Publication title -
new disease reports
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.184
H-Index - 4
ISSN - 2044-0588
DOI - 10.5197/j.2044-0588.2011.024.025
Subject(s) - biology , diaphorina citri , weed , parthenium hysterophorus , botany , noxious weed , horticulture , hemiptera
Citrus huanglongbing (HLB) also known as citrus greening is the most destructive disease of citrus worldwide. Three species of the causal organism have been identified. These are ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. africanus’ and ‘Ca. L. americanus’ (Bove, 2006). In 2010 a survey of non-citrus plants was conducted on two major citrus producing farms in Clarendon and St Catherine in Jamaica. This was to determine the possibility of the existence of non-citrus hosts of HLB. A total of 120 plants belonging to 10 different species and nine families were collected over a period of two months. The plants collected included weeds as well as non-citrus trees. None of the plants collected exhibited any symptoms of HLB and at the time of sample collection, no citrus psyllids was observed on the plants. DNA was extracted from plant samples using the method of Dellaporta et al. (1983) and analysed by PCR using the primer pair OI1 (5` GCGCGTATGCAATACGAGCGGCA3`) and OI2c (5`GCCTCGCGACTTCGCAACCCAT 3`). DNA obtained from a confirmed HLB infected citrus plant from Florida served as the positive control whereas DNA from a citrus plant uninfected by HLB was used as the negative control.

The content you want is available to Zendy users.

Already have an account? Click here to sign in.
Having issues? You can contact us here
Accelerating Research

Address

John Eccles House
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom