Open AccessKajian Molekuler Layu Buah Muda Kakao (Theobroma cacao L.): Ekspresi TcPIN1 Like Gene
Author(s) -
Yohana Theresia Maria Astuti,
Kumala Dewi,
Santosa Santosa,
Adi Prawoto
Publication year - 2019
Publication title -
biota
Language(s) - English
Resource type - Journals
eISSN - 2527-323X
pISSN - 2527-3221
DOI - 10.24002/biota.v15i3.2591
Subject(s) - theobroma , primer (cosmetics) , biology , gene , horticulture , microbiology and biotechnology , botany , genetics , chemistry , organic chemistry
This experiment was carried out to evaluate the expression of TcPIN1 like gene in cocoa (Theobroma cacao L.). DNA and RNA were extracted from 7 weeks old of both healthy and cherelle wilt cocoa pods. PCR was done with two primer set based on PIN1 sequenced of Arabidopsis. Primer PIN1-1: Forward: taaggtgatgccaccaacaa; Reverse: gccatgaacaacccaagact. Primer PIN!-2: Forward: tttgtgtggagctcaagtgc; Reverse: ctgcgtcgttttgttgctta. RT-PCR was done with primer PIN1-2. The results showed that TcPIN1-2 like gene was found in healthy young pods, but not availabe in cherelle wilt pods of cocoa.