z-logo
open-access-imgOpen Access
Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence
Author(s) -
K. Kiran,
B. V. Sandeep
Publication year - 2021
Publication title -
plant science today
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.204
H-Index - 6
ISSN - 2348-1900
DOI - 10.14719/pst.2021.8.3.1133
Subject(s) - phylogenetic tree , biology , botany , maximum parsimony , phylogenetics , gene , genetics , clade
Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

The content you want is available to Zendy users.

Already have an account? Click here to sign in.
Having issues? You can contact us here