Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding
Author(s) -
Stefanie Jessica Henny Larasati,
Agus Sabdono,
Mada Triandala Sibero
Publication year - 2021
Publication title -
journal of marine research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.442
H-Index - 66
ISSN - 2407-7690
DOI - 10.14710/jmr.v10i1.28334
Subject(s) - biology , botany
Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom