
Development of primers specific for LMW‐GS genes located on chromosome 1D and molecular characterization of a gene from Glu‐D3 complex locus in bread wheat
Author(s) -
ZHAO HUIXIAN,
WANG RUIJUAN,
GUO AIGUANG,
HU SHENGWU,
SUN GENLOU
Publication year - 2004
Publication title -
hereditas
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.819
H-Index - 50
eISSN - 1601-5223
pISSN - 0018-0661
DOI - 10.1111/j.1601-5223.2004.01852.x
Subject(s) - biology , locus (genetics) , gene , genetics , chromosome
Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus‐specific primers is an important step toward cloning specific LMW glutenin subunits (LMW‐GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5′ TTGTAGAAACTGCCATCCTT 3′) and primer 4 (5′ GTCACCGCTGCAT CGACATA 3′) was designed and verified to specific for LMW‐GS genes located on chromosome 1D in this study. The LMW‐GS gene located at the Glu‐D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3‐LMWGS1 (AY263369), contains the endosperm‐specific‐expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3‐LMWGS1 with other reported LMW‐GS genes located at different Glu‐3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW‐GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3‐LMWGS1 with the sequences of 12 group LMW‐GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW‐GS group 10 (identity 99.67%). The deduced LMW‐GS contains nine cystine residues, which contained one more cystine residue in the C‐terminal conserved domain than previous reported. This was the first LMW‐GS gene encoding for a LMW‐GS with 9 cystine residues that has been discovered so far.