Open AccessRelationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer
Author(s) -
Bardakci F.,
Canbay E.,
Degerli Naci,
Coban L.,
Canbay E. I.
Publication year - 2003
Publication title -
journal of cellular and molecular medicine
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.44
H-Index - 130
eISSN - 1582-4934
pISSN - 1582-1838
DOI - 10.1111/j.1582-4934.2003.tb00231.x
Subject(s) - genotype , cancer , biology , gene , laryngeal neoplasm , medicine , case control study , polymorphism (computer science) , gastroenterology , genetics , carcinogen , microbiology and biotechnology , oncology
This paper aimed to analyze the association of polymorphism of GSTM1 0/0 genotype with laryngeal cancer along a hospital based case‐control study. Polymorphisms of GSTM1 0/0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method. The reaction used as GSTM1 primers, using the sequence sense: 5′‐CTGCCCTACTTGGATTGATGGG‐3′ and antisense: 5′‐TGGATTGTAGCAGATCATGC‐3′. N Acetyl transferase 1 (NAT1) gene using the primers sense: 5′‐TAAAAGTAAAATGATTTGCTTTCG‐3′ and antisense: 5′‐GCTTTCTAGCATAAATCACCAA‐3′ was used as internal positive control. Two sided 2 and multivariation analysis were used to analyse the results. The proportions of GSTM1 deleted genotype in cases and controls were 47.2% and 54.3%, respectively. There was significant increment of GSTM 0/0 genotype frequency in moderate smokers group of patients compared to control (P=0.033, OR= 4.78, 95% CI=1.30‐7.13). We conclude that GSTM1 deleted genotype may be a genetic susceptibility marker for laryngeal cancer whose exposed to low doses carcinogens. The absence of this enzyme seems to have a role in the development of laryngeal cancer, in which the mechanism still needs further investigation.