Premium
Study of Cytochrome P4502E1 mRNA Level of Mononuclear Cells in Patients With Alcoholic Liver Disease
Author(s) -
Yano Hirokazu,
Tsutsumi Mikihiro,
Fukura Masayuki,
Chen WunBil,
Shimanaka Koshi,
Tsuchishima Mutsumi,
Takase Shujiro,
Imaoka Susumu,
Funae Yoshihiko
Publication year - 2001
Publication title -
alcoholism: clinical and experimental research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.267
H-Index - 153
eISSN - 1530-0277
pISSN - 0145-6008
DOI - 10.1111/j.1530-0277.2001.tb02408.x
Subject(s) - peripheral blood mononuclear cell , alcoholic liver disease , microbiology and biotechnology , messenger rna , cyp2e1 , rna , biology , alcoholic hepatitis , polymerase chain reaction , cirrhosis , cytochrome p450 , gene , enzyme , medicine , biochemistry , in vitro
Background: Cytochrome P‐4502E1 (CYP2E1) is an important enzyme because of its unique ability to convert many substrates to cytotoxins. The increased production of reactive intermediates by elevated enzyme concentrations leads to various pathological conditions. Therefore, it is important to detect induced CYP2E1 levels in alcoholic individuals to avoid xenobiotic‐promoted liver injury. In the present investigation, we detected CYP2E1 mRNA levels of mononuclear cells obtained from 10 ml of blood by using competitive polymerase chain reaction (PCR) method. Methods: Mononuclear cells were obtained from healthy individuals who did and did not drink habitually and patients with alcoholic liver disease (ALD). Complementary DNA synthesis was performed with RNA obtained from mononuclear cells by reverse transcription‐PCR. Competitive PCR of CYP2E1 was performed with the sense (5′‐CTGCAACGTCATA‐GCCGACA‐3′) and antisense (5′‐TCCATTTCCACGAGCAGGCA‐3′) primer and competitor DNA. Competitive PCR of β‐actin also was performed. Electrophoresis was scanned, and each band was digitized. The concentration of CYP2E1 and β‐actin mRNA was calculated from the ratio of competitor DNA. Results: In healthy individuals who did and did not drink habitually, CYP2E1 mRNA levels were 10 3.3 copies/μl RNA and 10 1.7 copies/μl RNA, respectively. In actively drinking patients with ALD, CYP2E1 mRNA levels were 10 3.5 copies/μl RNA, but those levels decreased to 10 1.7 copies/μl RNA after 4 days of abstinence. No significant difference was observed in CYP2E1 mRNA levels between alcoholic fibrosis and cirrhosis. As control, we measured β‐actin mRNA levels in mononuclear cells in all samples. The mean value of β‐actin mRNA was 10 4.3 copies/μl RNA in all cases, which included patients with ALD. Conclusions: The results demonstrated that it is possible to measure the CYP2E1 mRNA levels of mononuclear cells in a 10 ml blood sample. The CYP2E1 mRNA level in mononuclear cells increases during drinking and decreases in abstinence for a short period of 3 to 4 days. It is concluded that CYP2E1 mRNA level may be used as an effective marker for alcoholic intake.