Premium
Interaction of a redox‐sensitive DNA‐binding factor with the 5′‐flanking region of the micF gene in Escherichia coli
Author(s) -
Gidrol Xavier,
Farr Spencer
Publication year - 1993
Publication title -
molecular microbiology
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.857
H-Index - 247
eISSN - 1365-2958
pISSN - 0950-382X
DOI - 10.1111/j.1365-2958.1993.tb00958.x
Subject(s) - biology , regulon , dna , gene , escherichia coli , microbiology and biotechnology , transcription factor , binding site , biochemistry
Summary The product of the micF gene is an endogenous anti‐sense RNA which down‐regulates the expression of a major outer membrane protein, OmpF, in E. coli. We report here that two DNA‐binding factors compete for the same site in the promoter region of the micF gene: RSBF, a high‐affinity redox‐sensitive DNA‐binding factor that responds to an active oxygen species other than hydrogen peroxide or superoxide anions; and HRBF a heat‐resistant DNA‐binding factor. Both RSBF and HRBF bind to the same DNA sequence, 5′‐TTAAAATCAATAACTTATTCTTAA3‐′, located upstream of the transcription start site of the micF gene. We present evidence that RSBF could be the controlling factor of a novel regulon involved in the response to oxidative stress in E. coli.