Primers for the differential amplification of the sex‐determining region Y gene in a range of mammal species

There are three circumstances in which sex identification in mammals can pose a problem. The first occurs when the animal itself is absent but has left tissues behind in hair follicles, blood or even faeces. The second is when the mammal is embryonic, and the third when sex linked morphological cues are absent or difficult to observe, as in many cetations. Under each of these circumstances sex identification can be achieved through the identification of Y-chromosome-linked markers at the molecular level. To facilitate this procedure, PCR is becoming widely used because it is fast and can be applied to small or degraded DNA samples. An obvious target locus is the sex determining region Y gene (SRY) which is ubiquitous to the class (Gubbay et al. 1990; Sinclair et al. 1990; Foster et al. 1992). Although primers to SRY have been published elsewhere, these are designed with particular species in mind (Palsb0ll et al. 1992; Peyen & Cotinot 1993). The primers described here are more widely applicable. They allow the amplification of a 216bp product from the SRY gene in representatives of six of the eight mammalian orders tested. The primer RG4 (CGTCAAGCGACCCATGAA(C/T) GCNTT; where parenthesized nucleotides indicate partial degeneracies and 'N' total degeneracy) has been described previously (Griffiths 1991) and is designed to complement part of the conserved HMG-box region common to members of the SOX gene family, including SRY. In contrast, RG7 (GGTCGATACTTATAGTTCGGGTA(C/T)TT) was designed to anneal to especially conserved regions of the SRY HMG-box in the mouse, human and rabbit (Gubbay et a/. 1990; Sinclair et al. 1990) but not the homologous region of autosomal SOX sequences from the mouse (four sequences J. Collignon pers comm.) and lesser black-backed gull Larus fiisct~s (Griffiths 1991).