Premium
AMPKα2 Overexpression Induces IL‐15 mRNA Expression Independent of IL‐15Rα Protein Expression
Author(s) -
Tomac Michael P,
Macias Angel V,
Pham Anton D,
Abbott Marcia J
Publication year - 2017
Publication title -
the faseb journal
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.709
H-Index - 277
eISSN - 1530-6860
pISSN - 0892-6638
DOI - 10.1096/fasebj.31.1_supplement.lb698
Subject(s) - ampk , transfection , messenger rna , microbiology and biotechnology , green fluorescent protein , myokine , biology , chemistry , protein kinase a , phosphorylation , gene , skeletal muscle , endocrinology , biochemistry
One potential path for treating obesity lies in understanding molecular regulators of metabolism. Myokines have the potential to regulate metabolic processes. Interleukin‐15 (IL‐15) is a myokine that has been shown to decrease body fat, improve insulin sensitivity, and increase skeletal muscle mass. However, little is known about upstream regulators of IL‐15 expression and/or secretion. Previous studies have shown that AMPK is involved in increasing IL‐15 mRNA expression levels. Nevertheless, the specific molecular mechanism by which AMPK acts to increase IL‐15 expression has not been identified. We aimed to elucidate the mechanism by which AMPK acts to increase IL‐15 expression. Human embryonic kidney cells (HEK293) were transfected with AMPKα2 (AMPK) tagged with green fluorescent protein (GFP) or with GFP alone (V). The transfection was confirmed by fluorescent microscopy. Protein and RNA was isolated 48 hours following transfection. RNA was reverse transcribed to cDNA. IL‐15 expression was measured by real‐time quantitative PCR (qPCR), and normalized to GAPDH. IL‐15, IL‐15 receptor alpha (IL‐15Rα), and specificity protein 1 (SP1) protein levels were measured by Western Blot with GAPDH as loading control. To determine potential transcription factors that link AMPK to IL‐15 expression, bioinformatics tools were used. Prediction of the IL‐15 promoter sequence was carried out using the Eukaryotic Promoter Database. The TFBIND tool, TRANSFAC R.3.4, was used to predict transcriptional regulators of IL‐15. GFP expression was confirmed in the V and AMPK cells. IL‐15 mRNA levels increased 95% in the AMPK cells compared to V ( p <0.05). However, IL‐15 protein levels were 50% lower in the AMPK cells when compared to V ( p <0.01). There was no change in IL‐15Rα protein levels. The predicted promoter sequence of IL‐15 was ggccgccccgccctctttcttgaccaagacttcaatactcagtggcactgtattcccctt. Using the predicted sequence, 47 potential transcriptional factors were identified. Of the transcription factors, SP1 was predicted to interact with the IL‐15 promoter sequence within 7 different regions. However, there were no corresponding alterations in SP1 protein levels with AMPK. Our data demonstrates that AMPKα2 regulates IL‐15 mRNA expression. However, increased AMPKα2 expression resulted in a decrease in intracellular IL‐15 protein. The decrease in IL‐15 protein levels, with AMPKα2 overexpression, may be attributed to an increase in secretion of IL‐15. Although SP1 was highly predicted as an intermediary between AMPKα2 and IL‐15 expression, its protein levels remained unchanged with increased AMPKα2 expression. The lack of increase in SP1 expression does not rule out the possibility for increased interaction between AMPKα2 and SP1, or SP1 and IL‐15. Taken together, we show that AMPKα2 regulates IL‐15 mRNA expression, but the specific transcriptional regulators remain unknown. Further studies are warranted to unravel upstream regulators of IL‐15 expression for potential routes to treat obesity. Support or Funding Information The American College of Sports Medicine Research Foundation, Chapman University Faculty and Undergraduate Scholarly Research Grants
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom