Premium
ANALYSIS OF RS12976445 VARIANT IN MIR125A AND FEMALE INFERTILITY IN LAGOS, NIGERIA
Author(s) -
Gbenle segun A.,
Igwo-Ezikpe Miriam,
Taiwo Idowu A.,
Salami Fatimah O.,
Chukwuso Chinwedu F.,
Ofoma Osita N.,
Onawoga Fatimah O.
Publication year - 2020
Publication title -
the faseb journal
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.709
H-Index - 277
eISSN - 1530-6860
pISSN - 0892-6638
DOI - 10.1096/fasebj.2020.34.s1.09623
Subject(s) - infertility , fertility , male infertility , medicine , in vitro fertilisation , unexplained infertility , gynecology , female infertility , andrology , reproductive medicine , physiology , biology , genetics , population , pregnancy , environmental health
Micro RNAs play very important roles in maintaining normal human body physiology conditions, meanwhile, abnormal miRNA expressions have been found related to many human diseases including male and female infertility. Reports have indicated that disturbed miRNAs expression contributed to female infertility with reference to a polymorphism (rs12976445) within the miRNA125a sequence. This aim of the study was to investigate the effects of MiRNA125a gene disorders on female infertility and how these can be used in enhancing fertility among women seeking in vitro fertilization (IVF) in Lagos, Nigeria. Ethical approval was obtained from the Lagos University Teaching Hospital Health Research Ethics Committee (LUTHHREC) with number ADM / DCST / HREC / APP / 2396. Infertile women (n=50) attending various fertility clinics in Lagos, Nigeria were recruited for this study and structured self‐administered questionnaires were distributed to the subjects to obtain their physiological and demographic parameters. DNA were extracted and amplified from blood samples obtained from subjects using primers specific for miR125a sequencing 5′‐TTTTGGTCTTTCTGTCTCTGG‐3′ and 5′‐TGGAGGAAGGGTATGAGGAGT‐3′. PCR products were analyzed using a BaeGI restriction enzyme specific to the rs12976445 variant. The restriction analysis revealed that 6 out of 50 subjects were TT homozygotes (12%) which were normal, 21 (42%) were TC heterozygotes variants and 23 (46%) were CC homozygotes variants. We hypothesized that rs12976445 may be a potential diagnostic marker of miR125a in female infertility among Nigerian women. Hence, mir125a should be considered in female infertility treatment. Support or Funding Information NA
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom