Premium
Inactivation of Gene α‐1,3‐Galactosyltransferase in Bovine Aortic Smooth Muscle Cells Using CRISPR‐Cas9
Author(s) -
Wang Xiaodan,
Apple Jason,
Huang Yan
Publication year - 2018
Publication title -
the faseb journal
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.709
H-Index - 277
eISSN - 1530-6860
pISSN - 0892-6638
DOI - 10.1096/fasebj.2018.32.1_supplement.649.7
Subject(s) - crispr , genome editing , guide rna , biology , gene , galactosyltransferase , epitope , cas9 , exon , transcription activator like effector nuclease , genetics , microbiology and biotechnology , antigen , biochemistry , enzyme
People who get bites from Amblyomma americanum usually develop a severe allergic reaction to red meat. The main reason caused this allergy is because of the presence of α‐1,3‐galactosyl epitopes on the membranes of most mammalian cells. Since human beings do not create galactose‐ alpha ‐1,3‐galactose (alpha‐gal), the patients' immune system is free to start attacking alpha‐gal when they eat red meat. The epitope transferase coded geneα‐1,3‐galactosyltransferase (GGTA1) was already identified, and it can be knocked out to solve the allergy of eating red meat. GGTA1 gene has successfully knocked out in pigs. However, there is no evidence to show the GGTA1 gene has been knocked out in beef. In this study, we utilized bovine aortic smooth muscle cells (BAOSMC) as the module for the research of GGTA1 gene knockout. The clustered regularly interspaced short palindromic repeats (CRISPR) systems are widely used in performing targeted genome editing in cultured cells. The use of CRISPR‐associated (Cas) systems as an RNA‐programmable DNA targeting and editing platform is followed by a synthetic single‐guide RNA (sgRNA), which can simply edit genome sequences like other tools such as transcription activator‐like effector nucleases (TALENs) and zinc‐finger nucleases (ZFNs). We used the gRNA design tool and selected 5′‐GGCCTGACGGTTTTCGCCGT‐3′ as the target gRNA sequence from the coding DNA sequence of Bos taurus alpha‐galactosyltransferase 1 (glycoprotein). The gRNA was constructed in the pSpCas9 BB‐2A‐GFP (PX458) vector provided by GenScript USA Inc. Vectors were amplified and transfected into BAOSMC by GenePORTER2 transfection reagent when the cells were 80% confluency. Green fluorescent can be viewed after 24 hours transfection (Fig. 1). The transfection efficiency can reach about 70% to 80%. Cells were collected in PBS at pH7.4 after 24 hours transfection. Total protein was extracted then the enzyme‐linked immunosorbent assay was used to examine the GGTA1 production. By normalized with the total protein concentration, the GGTA1 protein level in the transfected cells was 17.9 ± 7.25% lower ( P < 0.05) than in the control cells, showing a significant inhibition of GGTA1 gene expression in the cells by CRISPR‐Cas9 gene edition method (Fig. 2). Our data show that the gRNA sequence that we chose was suitable for the GGTA1 gene knockout in BAOSMC. Moreover, the CRISPR‐Cas9 system was proved can be applied in the genome editing of bovine cells. Support or Funding Information This study is funded by Arkansas Beef Council. This abstract is from the Experimental Biology 2018 Meeting. There is no full text article associated with this abstract published in The FASEB Journal .
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom