Open AccessThe nucleotide sequence of 5S ribosomal RNA from Micrococcus Iysodeikticus
Author(s) -
Hiroshi Hori,
Syozo Osawa,
Kazuya Murao,
Hisayuki Ishikura
Publication year - 1980
Publication title -
nucleic acids research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 9.008
H-Index - 537
eISSN - 1362-4954
pISSN - 0305-1048
DOI - 10.1093/nar/8.22.5423
Subject(s) - biology , thermus aquaticus , thermus , ribosomal rna , micrococcus , nucleic acid sequence , 5s ribosomal rna , genetics , rna , homology (biology) , bacteria , 5.8s ribosomal rna , nucleotide , 18s ribosomal rna , ribosome , microbiology and biotechnology , dna , gene , thermophile
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.