The nucleotide sequence of 5S ribosomal RNA from Micrococcus Iysodeikticus | Zendy

Hiroshi Hori | Zendy; Syozo Osawa | Zendy; Katsutoshi Murao | Zendy; Hisayuki Ishikura | Zendy

AI Assistant Blog Pricing

Home ZAIA Blog

Open Access

The nucleotide sequence of 5S ribosomal RNA from Micrococcus Iysodeikticus

Author(s) -

Hiroshi Hori,

Syozo Osawa,

Katsutoshi Murao,

Hisayuki Ishikura

Publication year - 1980

Publication title -

nucleic acids research

Language(s) - English

Resource type - Journals

SCImago Journal Rank - 9.008

H-Index - 537

eISSN - 1362-4954

pISSN - 0305-1048

DOI - 10.1093/nar/8.22.5423

Subject(s) - biology , thermus aquaticus , thermus , ribosomal rna , micrococcus , nucleic acid sequence , 5s ribosomal rna , genetics , rna , homology (biology) , bacteria , 5.8s ribosomal rna , nucleotide , 18s ribosomal rna , ribosome , microbiology and biotechnology , dna , gene , thermophile

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

The content you want is available to Zendy users.

Already have an account? Click here to sign in.

Having issues? You can contact us here

Accelerating Research