Characterization of the ung1 mutation ofEscherichia coli

Uracil DNA glycosylase (ung) excises uracil residues from DNA which arise as a result of either deamination of cytosine or mis incorporation of dUMP residues by DNA polymerase. Ung" mutants of E^ coll e.g. BW310 (1) have a high rate of GC—AT mutations. An Ê _ coli ung"strain also deficient in dUTPase (dut"), RZ1032 (2) can have as much as 14* uracil substituted for thymine and is used in site directed mutagenesis (3) where a deaminated cytosine residue is to be preserved or the uracil containing DNA template is to be destroyed (1,2,3). Since the complete nucleotide sequence of ung (w.t.) has recently been described (4), it was of interest to define the mutations in the ung gene of these strains and explain the molecular mechanisms that render them ung" Approximately 1.0 /ig of chromosomal DNA from different strains of E. coll were mixed with 0.1 nmole of 5'sense (GCAGTTAAGCTAGGCGGATTG) and 3'antisense (TGCCATCCGGCATTTCCCC) primers in lOO/il in the presence of 50mM KC1, lOmM Tris (pH 8.3), 1.5mM MgCl., 200 /iM dNTPs, 2 units Taq DNA polymerase and subjected to 23 cycles of incubations as follows: 1 mln. at 92*C, 2 min at 37*C and 4 mln at 65*C(5). Following this polymerase chain reaction, agarose gel electrophoresls of 2.0^1 allquots showed amplification of a 0.75 kbp fragment encompassing the whole ung gene (Fig. 1, marked with an arrow head). This fragment was gel purified and subjected to sequence analysis from both ends using the above mentioned primers and AMV reverse transcriptase. The sequence of the ung gene from strain HB1O1 (ung) was identical to the wild type ung sequence (4). Sequences of the ung genes form RZ1O32 and BW310 were identical to each other as they both possessed the same allele (ungl) (1,3) but showed a single base (G) (marked with an arrow, Fig. 2) deletion in the 43rd codon when compared to the wild type sequence. This deletion leads to a shift in the reading frame and a premature termination 16 amino acids downstream from it (Fig.2). The reading frame of the wild type gene codes for a protein of 229 amino acids before encountering its natural termination codon (4). s