α-DNA VII. Solid phase synthesis of α-anomeric oligodeoxyribonucleotides
Author(s) -
F. Morvan,
Bernard Rayner,
JeanPaul Léonetti,
Jean-Louis Imbach
Publication year - 1988
Publication title -
nucleic acids research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 9.008
H-Index - 537
eISSN - 1362-4954
pISSN - 0305-1048
DOI - 10.1093/nar/16.3.833
Subject(s) - biology , dna , anomer , phase (matter) , nucleic acid thermodynamics , base sequence , microbiology and biotechnology , biochemistry , genetics , chemistry , organic chemistry
An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom