α-DNA VII. Solid phase synthesis of α-anomeric oligodeoxyribonucleotides | Zendy

F. Morvan | Zendy; Bernard Rayner | Zendy; JeanPaul Léonetti | Zendy; Jean-Louis Imbach | Zendy

AI Assistant Blog Pricing

Home ZAIA Blog

Open Access

α-DNA VII. Solid phase synthesis of α-anomeric oligodeoxyribonucleotides

Author(s) -

F. Morvan,

Bernard Rayner,

JeanPaul Léonetti,

Jean-Louis Imbach

Publication year - 1988

Publication title -

nucleic acids research

Language(s) - English

Resource type - Journals

SCImago Journal Rank - 9.008

H-Index - 537

eISSN - 1362-4954

pISSN - 0305-1048

DOI - 10.1093/nar/16.3.833

Subject(s) - biology , dna , anomer , phase (matter) , nucleic acid thermodynamics , base sequence , microbiology and biotechnology , biochemistry , genetics , chemistry , organic chemistry

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.

The content you want is available to Zendy users.

Already have an account? Click here to sign in.

Having issues? You can contact us here

Accelerating Research