The nucleotide sequence of 5S rRNA from a red alga,Porphyra yeioensis
Author(s) -
Fumio Takaiwa,
Mie Kusuda,
Naotsune Saga,
Masahiro Sugiura
Publication year - 1982
Publication title -
nucleic acids research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 9.008
H-Index - 537
eISSN - 1362-4954
pISSN - 0305-1048
DOI - 10.1093/nar/10.19.6037
Subject(s) - biology , euglena gracilis , porphyra , nucleic acid sequence , homology (biology) , ribosomal rna , genetics , euglena , nucleotide , sequence (biology) , microbiology and biotechnology , botany , gene , algae , chloroplast
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAAAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom