z-logo
open-access-imgOpen Access
The nucleotide sequence of 5S rRNA from a red alga,Porphyra yeioensis
Author(s) -
Fumio Takaiwa,
Mie Kusuda,
Naotsune Saga,
Masahiro Sugiura
Publication year - 1982
Publication title -
nucleic acids research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 9.008
H-Index - 537
eISSN - 1362-4954
pISSN - 0305-1048
DOI - 10.1093/nar/10.19.6037
Subject(s) - biology , euglena gracilis , porphyra , nucleic acid sequence , homology (biology) , ribosomal rna , genetics , euglena , nucleotide , sequence (biology) , microbiology and biotechnology , botany , gene , algae , chloroplast
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAAAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

The content you want is available to Zendy users.

Already have an account? Click here to sign in.
Having issues? You can contact us here
Accelerating Research

Address

John Eccles House
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom