Open AccessThe nucleotide sequence of chlorophst 5S ribosomal RNA from a fern,Dryopteris acuminaia
Author(s) -
Fumio Takaiwa,
Masahiro Sugiura
Publication year - 1982
Publication title -
nucleic acids research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 9.008
H-Index - 537
eISSN - 1362-4954
pISSN - 0305-1048
DOI - 10.1093/nar/10.17.5369
Subject(s) - fern , biology , sequence (biology) , dryopteris , ribosomal rna , genetics , botany , gene
Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCCCCU-GCGGUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.