Open AccessPiscicola geometra (Linnaeus, 1761) leech parasitizing two fish species hosts from Greater Zab near Aski-Kalak, Kurdistan-Iraq, morphological and molecular investigations
Author(s) -
Sh. J. Hamad-Ali,
Luay A. Ali
Publication year - 2021
Publication title -
iop conference series. earth and environmental science
Language(s) - English
Resource type - Journals
eISSN - 1755-1307
pISSN - 1755-1315
DOI - 10.1088/1755-1315/761/1/012113
Subject(s) - leech , biology , zoology , parasite hosting , cyprinus , fish <actinopterygii> , primer (cosmetics) , anatomy , fishery , chemistry , organic chemistry , world wide web , computer science
Samples of two fish species, Cyprinus carpio and Silurus triostegus were collected from Aski-Kalak and inspected for the presence of parasitic leeches from March 2018 to February 2019 with a prevalence of 6.66 and 8.33 and mean intensity 0.10 and 0.11 respectively. Both hosts’ species were regarded as new hosts for this parasite in Iraq since no previous reports in this country. Collected leeches were fixed, preserved, and identified based on morphological and molecular techniques. For molecular identification, amplification and sequencing of 18S rDNA, with forward primer C1, (ACCCGCTGAACTTTAAGCAT, position 25), and reverse primer C3, (CTCTTCAGAGTACTTTTCAAC, position 390) were studied, while morphological identification based on well descried, and distinguished by focusing on color patterns, number vis arrangement of eyes, body annulations, gonopores shape and location, shape, location and size of body parts, in addition to some species-specific characters, criteria’s were documented by photographing and drawing illustrations.