z-logo
Premium
Frequency and functional relevance of genetic threonine 145 /methionine 145 dimorphism in platelet glycoprotein Ibα in an Italian population
Author(s) -
Mazzucato M.,
Pradella P.,
Angelis V. de,
Steffan A.,
Marco L. de
Publication year - 1996
Publication title -
transfusion
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.045
H-Index - 132
eISSN - 1537-2995
pISSN - 0041-1132
DOI - 10.1046/j.1537-2995.1996.361097017175.x
Subject(s) - alpha (finance) , platelet , relevance (law) , population , sexual dimorphism , clinical significance , biology , genetics , medicine , immunology , political science , surgery , environmental health , construct validity , law , patient satisfaction
Background: Threonine 145 /methionine 145 dimorphism in platelet glycoprotein (GP) Ibα defines the human platelet antigen (HPA)‐2 system that has been implicated in refractoriness to HLA‐matched platelet transfusion and in neonatal immune thrombocytopenic purpura. Study Design and Methods: The occurrence of this amino acid dimorphism was investigated in 379 Italian blood donors by studying their genomic DNA. Two oligonucleotide primers, Ibα‐3 (5′‐GGACGTCTCCTTCAACCGGC‐3′) and Ibα‐4 (5′‐GCTTTGGTGGGGAACTTGAC‐3′), were used in a polymerase chain reaction to generate a 591‐base pair fragment that was digested with the restriction enzyme Acy I. To investigate whether this dimorphism is involved in the binding of von Willebrand factor (vWF) to GPlb, the binding of vWF to the GPlb/IX complex was measured in two Met 145 /Met 145 and two Thr 145 /Thr 145 subjects. Results: The genotypic frequencies are 78.9% for Thr/Thr, 19.8% for Thr/Met), and 1.3% for Met/Met; the allelic frequencies are 88.8% for Thr 145 and 11.2% for Met 145 . Estimates for binding of subunit molecules per platelet at saturation and inhibition constant in mol per L, respectively, follow. In the presence of ristocetin (0.5 mg/mL), they are 11,460 ± 2,040 and 1.26 ± 0.44 × 10 −8 for normals and 11,230 ± 2,330 and 1.29 ± 0.48 × 10 −8 for patients. In the presence of botrocetin (2.5 μg/mL), they are 64,260 ± 7,760 and 2.99 ± 0.96 × 10 −8 for normals and 65,770 ± 11,570 and 2.47 ± 0.22 × 10 −8 for patients. Platelet aggregation responses obtained using platelet‐rich plasma from donors with Met 145 /Met 145 or Thr 145 /Thr 145 genotype were within normal limits. Conclusion: Genotypic and phenotypic frequencies in the HPA‐2 system in this population are consistent with those reported among the white population. Furthermore, the HPA‐2 system is not involved in the binding of vWF to GPlb.

This content is not available in your region!

Continue researching here.

Having issues? You can contact us here