Premium
Detection of Fusarium oxysporum f.sp. vasinfectum in cotton tissue by polymerase chain reaction
Author(s) -
Moricca S.,
Ragazzi A.,
Kasuga T.,
Mitchelson K. R.
Publication year - 1998
Publication title -
plant pathology
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.928
H-Index - 85
eISSN - 1365-3059
pISSN - 0032-0862
DOI - 10.1046/j.1365-3059.1998.00262.x
Subject(s) - biology , fusarium oxysporum , primer (cosmetics) , polymerase chain reaction , verticillium dahliae , ribosomal dna , fusarium , microbiology and biotechnology , verticillium , fungi imperfecti , internal transcribed spacer , pathogen , rhizoctonia solani , genomic dna , dna , ribosomal rna , botany , gene , genetics , phylogenetics , chemistry , organic chemistry
A polymerase chain reaction assay was developed for the detection of Fusarium oxysporum f.sp. vasinfectum (FOV), a serious wilt pathogen of cotton in many parts of the world. Based on small nucleotide differences in internal transcribed spacer sequences between 18S, 5.8S and 28S ribosomal DNAs, primers Fov1 (5′‐CCCCTGTGAACATACCTTACT‐3′) and Fov 2 (5′‐ACCAGTAACGAGGGTTTTACT‐3′) were selected. These primers unambiguously amplified a 400‐bp DNA fragment of all the FOV isolates tested (from Angola, Brazil, China and the USA) but did not amplify any other isolates of mycoflora associated with cotton, such as F. moniliforme , Verticillium albo‐atrum , V. dahliae , Aspergillus sp., F. oxysporum , F. sambucinum or F. solani . A control PCR assay was developed employing the universal primer pair ITS1 and ITS2 which amplified a fragment of approximately 220 bp from all isolates tested. This control assay demonstrated that all fungal DNAs were readily amplifiable, thus confirming that the lack of amplification with Fov1 and Fov2 primers was a result of primer specificity and not of other possible causes, such as DNA degradation or the presence of PCR inhibitors. The assay was effective on samples from the stems, leaves, roots and calli, and from plant tissues both with and without symptoms. This detection system proved to be accurate and sensitive and could aid not only diagnosis but also disease monitoring and forecasting.