Premium
Unmethylated CpG‐containing oligodeoxynucleotides inhibit apoptosis in WEHI 231 B lymphocytes induced by several agents: evidence for blockade of apoptosis at a distal signalling step
Author(s) -
MACFARLANE D. E.,
MANZEL L.,
KRIEG A. M.
Publication year - 1997
Publication title -
immunology
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 2.297
H-Index - 133
eISSN - 1365-2567
pISSN - 0019-2805
DOI - 10.1046/j.1365-2567.1997.00301.x
Subject(s) - apoptosis , microbiology and biotechnology , cpg oligodeoxynucleotide , biology , ceramide , chemistry , biochemistry , dna methylation , gene expression , gene
Certain oligodeoxynucleotides (ODN) containing cytosine followed by guanosine (CpG) protect B cells from apoptosis, and induce B‐cell proliferation and cytokine production. We investigated the effect of phosphorothioate CpG‐containing ODNs (5′‐ATAATCGACGTTCAAGCAAG‐3′ or 5′‐TCCATGACGTTCCTGACGTT‐3′) and control ODNs (which did not contain CpG) on apoptosis and cell growth in WEHI 231 murine B lymphoma cells. Anti‐surface ( α ‐s)IgM antibody induces 40–60% DNA degradation and growth arrest of WEHI 231 cells in 24 h. Both of these effects were substantially reversed by 30 ng/ml CpG‐ODN added up to 8 hr after α ‐sIgM. Control ODNs not containing the CpG motif were without effect. We explored various hypotheses to account for these effects. The phorbol ester, 12‐O‐tetradecanoyl phorbol‐13‐acetate, inhibits apoptosis induced by α ‐sIgM, but the anti‐apoptotic effect of CpG‐ODN was not affected by inhibitors of protein kinase C, indicating that CpG‐ODN does not act via protein kinase C. CpG‐ODN inhibited apoptosis and growth arrest induced by C 2 ‐ and C 8 ‐ceramide, sphingomyelinase and an intracellular Ca 2+ pump inhibitor thapsigargin, indicating that inhibition is not mediated via suppression of the ceramide cycle or suppression of Ca 2+ mobilization. CpG‐ODN partially inhibited apoptosis induced by okadaic acid, a protein phosphatase inhibitor, and by menadione, a free radical generator. CpG‐ODN also inhibited apoptosis and growth arrest induced by ultraviolet‐irradiation, glucocorticoid, vinca alkaloids, and doxorubicin. CpG‐ODN significantly protected cells from DNA fragmentation induced by α ‐sIgM in the presence of cycloheximide, but cycloheximide itself induces apoptosis which was unaffected by CpG‐ODN. These results suggest that CpG‐ODNs powerfully modulate the process by which immune cells are committed to death or proliferation by a mechanism acting on distal cell signalling events. CpG‐ODNs may be able to decrease immunosuppression in patients undergoing cancer chemotherapy.