z-logo
open-access-imgOpen Access
Detecting and differentiating Acremonium implicatum : developing a PCR‐based method for an endophytic fungus associated with the genus Brachiaria
Author(s) -
Kelemu Segenet,
Dongyi Huang,
Guixiu Huang,
Takayama Yuka
Publication year - 2003
Publication title -
molecular plant pathology
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.945
H-Index - 103
eISSN - 1364-3703
pISSN - 1464-6722
DOI - 10.1046/j.1364-3703.2003.00157.x
Subject(s) - biology , brachiaria , acremonium , genomic dna , endophyte , primer (cosmetics) , rapd , polymerase chain reaction , plant use of endophytic fungi in defense , dna , microbiology and biotechnology , botany , genetics , gene , genetic diversity , population , chemistry , demography , forage , organic chemistry , sociology
SUMMARY Brachiariais a pan‐tropical genus of grasses with about 100 species. The fungusAcremonium implicatumcan develop an endophytic association that is mutually beneficial withBrachiariaspecies. We developed a polymerase chain reaction (PCR)‐based method by first amplifying DNA fromA. implicatumisolates using the Random amplified polymorphic DNA (RAPD) technique with arbitrary 10‐mer primers. A 500‐bp PCR product, amplified with primer OPAK‐10 and common toA. implicatumisolates, was selected for further evaluation. The fragment was digoxygenin‐labelled and used to probe a dot blot containing genomic DNA from isolates ofA. implicatumand non‐endophytic fungi, and fromBrachiariaspecies free of endophytes. Strong signals were obtained only for DNA fromA. implicatumisolates. This fragment was cloned and subsequently sequenced. Based on the sequence data, two primers were selected and synthesized: P1 (5′‐TTCGAATGATAAGGCAGATC‐3′) and P4 (5′‐ACGCATCCACTGTATGCTAC‐3′). The primer pair amplified a single fragment of about 500 bp from DNA ofA. implicatumisolates, whether from pure culture or in association withBrachiariaplants. No amplification product was detected in DNA from endophyte‐free plants, pathogenic fungi, the bacteriumXanthomonas campestrispv.graminis, or non‐pathogenic fungi associated withBrachiaria. This assay thus allows the precise and rapid detection of endophytes inBrachiaria plants and permits a differentiation between endophytic and non‐endophytic fungi.

The content you want is available to Zendy users.

Already have an account? Click here to sign in.
Having issues? You can contact us here