Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape | Zendy

Ronan C. O’Malley | Zendy; Shaoshan Carol Huang | Zendy; Liang Song | Zendy; Mathew G. Lewsey | Zendy; Anna Bartlett | Zendy; Joseph R. Nery | Zendy; Mary Galli | Zendy; Andrea Gallavotti | Zendy; Joseph R. Ecker | Zendy

AI Assistant Blog Pricing

Home ZAIA Blog

Open Access

Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape

Author(s) -

Ronan C. O’Malley,

Shaoshan Carol Huang,

Liang Song,

Mathew G. Lewsey,

Anna Bartlett,

Joseph R. Nery,

Mary Galli,

Andrea Gallavotti,

Joseph R. Ecker

Publication year - 2016

Publication title -

cell

Language(s) - English

Resource type - Journals

SCImago Journal Rank - 26.304

H-Index - 776

eISSN - 1097-4172

pISSN - 0092-8674

DOI - 10.1016/j.cell.2016.08.063

Subject(s) - biology , dna , oligonucleotide , dna binding site , genetics , dna sequencing , computational biology , genomic dna , transcription factor , primer (cosmetics) , genome , gene , hmg box , dna binding protein , gene expression , promoter , chemistry , organic chemistry

In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 50 phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 50 P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 50-CAAGCAGAAGACGGCATAC GAGAT- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the represents the six-base-pair sequence index used for sample identification).

The content you want is available to Zendy users.

Already have an account? Click here to sign in.

Having issues? You can contact us here

Accelerating Research