z-logo
Premium
The nucleotide sequence of chloroplast 4.5 S rRNA from Mnium rugicum ( Bryophyta ) : mosses also possess this type of RNA
Author(s) -
Troitsky A.V.,
Bobrova V.K.,
Ponomarev A.G.,
Antonov A.S.
Publication year - 1984
Publication title -
febs letters
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.593
H-Index - 257
eISSN - 1873-3468
pISSN - 0014-5793
DOI - 10.1016/0014-5793(84)80921-7
Subject(s) - fern , moss , biology , ribosomal rna , phylogenetic tree , sequence (biology) , chloroplast , genetics , botany , gene
The complete nucleotide sequence of chloroplast 4.5 S rRNA from the moss Mnium rugicum was determined to be OH UAAGGUGACGGCAAGACUAGCCGUUUAUCAUCACGAUAGGUGCCAAGUGGAAGUGCAGUAAUGUAUGCAGCUGAGGCAUCCUAACAGACCGAGAGAUUUAAAC OH . The sequence differs from that of a fern Dryopteris acuminata and of angiosperms 4.5 S rRNA by 8 and 9–14%, respectively. The strong conservation of 4.5 S rRNA in the course of evolution ensures its use for reconstruction of the phylogenetic relations between the higher taxa of plants.

This content is not available in your region!

Continue researching here.

Having issues? You can contact us here