Premium
The nucleotide sequence of chloroplast 4.5 S rRNA from Mnium rugicum ( Bryophyta ) : mosses also possess this type of RNA
Author(s) -
Troitsky A.V.,
Bobrova V.K.,
Ponomarev A.G.,
Antonov A.S.
Publication year - 1984
Publication title -
febs letters
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.593
H-Index - 257
eISSN - 1873-3468
pISSN - 0014-5793
DOI - 10.1016/0014-5793(84)80921-7
Subject(s) - fern , moss , biology , ribosomal rna , phylogenetic tree , sequence (biology) , chloroplast , genetics , botany , gene
The complete nucleotide sequence of chloroplast 4.5 S rRNA from the moss Mnium rugicum was determined to be OH UAAGGUGACGGCAAGACUAGCCGUUUAUCAUCACGAUAGGUGCCAAGUGGAAGUGCAGUAAUGUAUGCAGCUGAGGCAUCCUAACAGACCGAGAGAUUUAAAC OH . The sequence differs from that of a fern Dryopteris acuminata and of angiosperms 4.5 S rRNA by 8 and 9–14%, respectively. The strong conservation of 4.5 S rRNA in the course of evolution ensures its use for reconstruction of the phylogenetic relations between the higher taxa of plants.