Premium
The Mammalian Hairless Protein as a DNA Binding Phosphoprotein
Author(s) -
Brook Lemlem,
Whitfield G. Kerr,
Hsieh David,
Bither Ryan D.,
Hsieh JuiCheng
Publication year - 2017
Publication title -
journal of cellular biochemistry
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.028
H-Index - 165
eISSN - 1097-4644
pISSN - 0730-2312
DOI - 10.1002/jcb.25641
Subject(s) - transactivation , phosphoprotein , immunoprecipitation , reporter gene , hek 293 cells , biology , microbiology and biotechnology , chromatin immunoprecipitation , phosphorylation , gene , hairless , promoter , gene expression , biochemistry
ABSTRACT The mammalian hairless (Hr) protein plays critical roles in skin and brain tissues, but how it interacts with DNA and partner protein is only now being defined. Our initial tests of four consensus response elements, revealed that rat Hr can specifically bind to a consensus p53 response element (p53RE), 5′‐AGACATGCCTAGACATGCCT‐3′, but not to response elements for NF‐κB, TCF4 or Sp1. We then employed ChIP assays which verified that human HR binds to a p53RE of the GADD45A gene in both HEK293 (embryonic kidney) and U87 (glioblastoma) cells. Further, HR was shown to interact directly with the p53 protein in a co‐immunoprecipitation assay. Cotransfections with p53RE reporter gene constructs revealed that rat Hr can boost p53‐mediated transactivation of a reporter gene linked to the GADD45A p53RE, but blunts p53‐mediated transactivation when the reporter gene is linked to a p21 promoter fragment containing a p53RE, with implications for the regulation of these two cell cycle control genes. Finally, our investigations of HR phosphorylation revealed that rat Hr is a substrate for PKC, but not PKA, and that human HR is phosphorylated in intact U87 cells at Ser‐416, located in a highly conserved region which partially fulfills the criteria of a PKC site. We propose that mammalian Hr is a phosphoprotein which can exert cross‐talk with the p53 pathway with important implications for the regulation of cell proliferation and differentiation in tissues such as skin and brain where Hr is highly expressed. J. Cell. Biochem. 118: 341–350, 2017. © 2016 Wiley Periodicals, Inc.