z-logo
Premium
Internal versus Terminal Metalation of Double‐Helical Oligodeoxyribonucleotides
Author(s) -
Vinje Jo,
Sletten Einar
Publication year - 2006
Publication title -
chemistry – a european journal
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.687
H-Index - 242
eISSN - 1521-3765
pISSN - 0947-6539
DOI - 10.1002/chem.200500731
Subject(s) - chemistry , random hexamer , adduct , stereochemistry , nuclear magnetic resonance spectroscopy , metal , titration , crystallography , inorganic chemistry , organic chemistry
The formation of adducts between cis ‐[Pt(NH 3 ) 2 Cl 2 ], Zn II , and Mn II and double‐stranded oligodeoxynucleotides was studied by 1D and 2D 1 H, 31 P, and 15 N NMR spectroscopy. For labile adducts involving Zn II and Mn II , both 1 H chemical shifts (Zn II ) and 1 H line‐broadening effects (Mn II ) showed that in the hexamer [d(GGCGCC)] 2 I , the terminal G 1 ‐N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)] 2 II , which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G 7 . Zn II binding to II was confirmed by natural‐abundance 2D [ 1 H, 15 N] HMBC NMR spectroscopy, which unambiguously showed that G 7 ‐N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)] 2 III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II . However, the Zn II titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II . The reaction between the nonlabile metal complex cis ‐[PtCl 2 ( 15 NH 3 ) 2 ] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis ‐[Pt( 15 NH 3 ) 2 (H 2 O) 2 ] was reacted with II a more pronounced binding preference for the internal GG pair was observed.

This content is not available in your region!

Continue researching here.

Having issues? You can contact us here
Accelerating Research

Address

John Eccles House
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom