Premium
Internal versus Terminal Metalation of Double‐Helical Oligodeoxyribonucleotides
Author(s) -
Vinje Jo,
Sletten Einar
Publication year - 2006
Publication title -
chemistry – a european journal
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 1.687
H-Index - 242
eISSN - 1521-3765
pISSN - 0947-6539
DOI - 10.1002/chem.200500731
Subject(s) - chemistry , random hexamer , adduct , stereochemistry , nuclear magnetic resonance spectroscopy , metal , titration , crystallography , inorganic chemistry , organic chemistry
The formation of adducts between cis ‐[Pt(NH 3 ) 2 Cl 2 ], Zn II , and Mn II and double‐stranded oligodeoxynucleotides was studied by 1D and 2D 1 H, 31 P, and 15 N NMR spectroscopy. For labile adducts involving Zn II and Mn II , both 1 H chemical shifts (Zn II ) and 1 H line‐broadening effects (Mn II ) showed that in the hexamer [d(GGCGCC)] 2 I , the terminal G 1 ‐N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)] 2 II , which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G 7 . Zn II binding to II was confirmed by natural‐abundance 2D [ 1 H, 15 N] HMBC NMR spectroscopy, which unambiguously showed that G 7 ‐N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)] 2 III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II . However, the Zn II titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II . The reaction between the nonlabile metal complex cis ‐[PtCl 2 ( 15 NH 3 ) 2 ] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis ‐[Pt( 15 NH 3 ) 2 (H 2 O) 2 ] was reacted with II a more pronounced binding preference for the internal GG pair was observed.