z-logo
Premium
Epithelial sodium channel and the mineralocorticoid receptor in cultured rat Müller glial cells
Author(s) -
Golestaneh Nady,
De Kozak Yvonne,
Klein Chistophe,
Mirshahi Massoud
Publication year - 2001
Publication title -
glia
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 2.954
H-Index - 164
eISSN - 1098-1136
pISSN - 0894-1491
DOI - 10.1002/1098-1136(200102)33:2<160::aid-glia1015>3.0.co;2-4
Subject(s) - epithelial sodium channel , biology , polyclonal antibodies , microbiology and biotechnology , mineralocorticoid receptor , receptor , antiserum , endocrinology , medicine , aldosterone , antibody , biochemistry , sodium , immunology , chemistry , organic chemistry
Müller glial cells are the major non‐neuronal cells of the retina. They are involved in retinal function and exert a profound influence on the function of retinal neurons. We present an in vitro study of the localization of the mineralocorticoid receptor (MCR) and of the epithelial sodium channel (ENaC) in rat Müller glial cells isolated from rat retina, using respectively, a polyclonal antiserum raised against the rat purified MCR, and a rabbit polyclonal antibody against the 14‐amino acid (aa) peptide QGLGKGDKREEQGL, which corresponds to the N‐terminal region (44–58aa) of the α‐subunit of the ENaC. In an immunocytochemical study using anti‐MCR and anti‐ENaC antibodies, the MCR was detected as a protein present in the cytoplasm and in the nucleus, whereas ENaC was detected as a membrane‐bound protein. Reverse transcription‐polymerase chain reaction (RT‐PCR) analysis using specific primers, 5′‐CTGCCTTTATGGATGATGGT‐3′ (sense), 5′‐GTTCAGCTCGAAGAAGA‐3′ (antisense) for ENaC and 5′‐AGGCTACCACAGTCTCCCTG‐3′ (sense) and 5′‐GCAGTGTAAAATCTCCAGTC‐3′ (antisense) for MCR, showed expression of the ENaC and MCR genes in Müller cells. The presence of ENaC and MCR was detected as the predicted bands of 520 bp and 843 bp, respectively. In both cases, 100% identity was observed between the sequences of rat Müller cell (RMC) PCR products and rat kidney. Interestingly, the basal levels of ENaC were increased in vitro by the MCR‐specific hormone, aldosterone. Thus, our results strongly suggest that the Müller glial cells may play a role in the regulation of extracellular Na + concentration, which could be regulated by steroid‐mediated sodium uptake. GLIA 33:160–168, 2001. © 2001 Wiley‐Liss, Inc.

This content is not available in your region!

Continue researching here.

Having issues? You can contact us here