z-logo
Premium
Inhibition of Angiogenesis In Vivo by ets‐1 Antisense Oligonucleotides—Inhibition of Ets‐1 Transcription Factor Expression by the Antibiotic Fumagillin
Author(s) -
Wernert Nicolas,
Stanjek Antje,
Kiriakidis Serafim,
Hügel Anja,
Jha Hem Chandra,
Mazitschek Ralph,
Giannis Athanassios
Publication year - 1999
Publication title -
angewandte chemie international edition
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 5.831
H-Index - 550
eISSN - 1521-3773
pISSN - 1433-7851
DOI - 10.1002/(sici)1521-3773(19991102)38:21<3228::aid-anie3228>3.0.co;2-8
Subject(s) - fumagillin , in vivo , angiogenesis , transcription factor , biology , transcription (linguistics) , pharmacology , microbiology and biotechnology , chemistry , cancer research , biochemistry , gene , genetics , linguistics , philosophy
The inhibition of angiogenesis in vivo as a result of the inhibition of Ets‐1 transcription factor expression by the ets‐1 phosphorothioate antisense oligodeoxynucleotide 5′‐AGATCGACGGCCGCCTTCAT‐3′ has been proven by experiments with chicken embryos. Thus, participation of the Ets‐1 transcription factor in the formation of new blood vessels in vivo has been demonstrated. Furthermore, it is shown that the angiostatic effect of the fungal metabolite and angiogenesis inhibitor fumagillin is mainly a result of its ability to inhibit Ets‐1 expression.

This content is not available in your region!

Continue researching here.

Having issues? You can contact us here