English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

Random amplification of polymorphic DNA (RAPD) amplification genomic DNA of 23 selected laboratory cultures of bacteria using RAPD revealed their polymorphism. Polymerase chain reaction (PCR) amplification of the bacterial 16SrDNA was performed using 704F GTAGCGGTGAAATGCGTAGA and 907R CCGTCAATTCCTTTGAGTTT primer, sequenced and accessed in NCBI (No. KY636356, KY631488, KY 860028, KX587470, KX665547, KY631489, KX608591, KY636360, KY671245, KY631490, KX587469, KY859856, KX665546, KX608590, KX587468, KY859798, KY636357, KY636361, KY 636359, KY631491, KY 859855, KY636358, KY636362) after submitting the contig. FASTA sequence in NCBI database was seen. All most all 23 bacterial strains (viz. TS-1-16, TS-4-23 DJ-1-22, DS-1-20, AS-1-4, DJ-1-24 , DJ-1-10, DJ-1-46) showed strong homology with free living nitrogen fixing soil bacteria, also showing (98 to 100%) identity and E-value of 00 with Burkholderia spp, Strain-S-9-19, Str-S-9-15, SP-2386, Stenotrophomonas maltophilla, strn-MM-3-3, Str-D-3,LP-05, Bacillus cereus Strn-FORC021and Azospirillum sp TSH51 gene, having good nitrogen fixing capacity. Phylogenetic tree analysis among the 23 isolates and between the different strains from GenBank showed close similarity. Most of the isolated bacterial strain identified as a member of the genus Burkholderia sp, Stenotrophomonas maltophila, Herbaspirillum sp, Acinetobacter johnsonii, Methylobacter, SP-T-20, and Bacillus cereus, Azospirillum sp would be consider to be the most suitable bioferiliser for organic and conventional tea gardens of North Bengal, India.       Key words: Molecular phylogeny, RAPD, 16SrRNA sequencing, free living, N2 fixing soil bacteria.

african journal of microbiology research

Identification and molecular phylogeny analysis using random amplification of polymorphic DNA (RAPD) and 16SrRNA sequencing of N2 fixing tea field soil bacteria from North Bengal tea gardens