The effect of DGAT1 polymorphism on milk production traits in dairycows depending on environmental temperature

* Correspondence: komisjol@up.poznan.pl Heat stress is a growing problem in dairy cattle breeding because of global warming and because of the genetic selection for greater production that reduces thermotolerance in cows. The negative influence of elevated environmental temperatures on economically important traits is well recognized in cattle. Thermal stress is responsible for decreased milk yield, milk fat, and protein contents, as well as reduced dry matter intake, health, and fertility (1,2). According to Gorniak et al. (2), even mild heat stress in cows kept in a temperate climate negatively affects milk production. Moreover, the decline in performance they observed could not be explained solely by reduced feed intake, and other factors, including changes in energy metabolism, might have contributed to decreased milk yield (2). At the physiological level, a hot environment was shown to induce several adaptive responses, including alterations of lipid metabolism (3). Acyl-coenzyme A:diacylglycerol transferase (DGAT1) is a lipogenic enzyme that plays a key role in the synthesis of triacylglycerols (4). An ApA to GpC dinucleotide substitution located in exon 8 of the bovine DGAT1 gene that replaces lysine (K) by alanine (A) in encoded protein (K232A polymorphism) has been proven to have a pronounced influence on milk yield and composition, especially on fat percentage in milk (5–7). Although in many cattle populations DGAT1:p.K232A alleles affected individual milk traits in the same direction, the magnitude of effects was variable between breeds (8), and during lactation (9). Recently, Akbar et al. (10) reported that the expression of this gene in the liver is reduced during the hot season. However, the impact of seasonal ambient air temperature changes on DGAT1 polymorphism effects is not known so far. The aim of this study was, therefore, to establish if the influence of K232A on milk production traits is dependent on environmental thermal conditions. The analyzed data set comprised 468 dairy cows of the Polish Holstein–Friesian (HF) breed, born between 1999 and 2002, and kept on the same farm under uniform environmental conditions. The animals were daughters of 109 sires, with the sire half-sib family sizes varying between 1 and 53. The average cow’s milk yield per 305day lactation was 7452 kg. DNA for molecular analyses was extracted from peripheral blood using the standard phenol method. The biological material was collected in accordance with the ethical standards of the Local Ethics Committee for Animal Research. Genotypes of DGAT1:p.K232A were determined using the PCR-RFLP method, as described by Szyda and Komisarek (11), with the use of the following primers (5’-3’): F:TGCCGCTTGCTCGTAGCTTTGGCC* and Abstract: It has long been known that a hot environment negatively influences milk production in cattle. Although molecular mechanisms underlying this phenomenon to a great extent remain to be recognized, they include alterations in lipid metabolism. DGAT1 plays a key role in the synthesis of triacylglycerols and polymorphism of this gene has been proven to have a pronounced influence on milk production. The aim of this study was to establish if the effect of DGAT1:p.K232A on milk-related traits is dependent on environmental thermal conditions. The analysis, performed on 468 cows of the Polish Holstein–Friesian breed, showed that allele DGAT1:K232 significantly increased milk content traits regardless of the temperature. However, its decreasing effect on milk and protein yields as well as the increasing influence on fat yield was not observed in hot weather. Results of this study suggest that the effect of DGAT1:p.K232A on some milk production traits is not constant and may depend on environmental thermal conditions.