Rapid communication: mapping the pig VCAM1 locus to chromosome 4 using a double-stranded conformation polymorphism marker (VCAM1-2).
Author(s) -
Christopher K. Tuggle,
Tao Yu,
H. Sunny Sun,
L Wang,
M. F. Rothschild
Publication year - 1997
Publication title -
journal of animal science
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.928
H-Index - 156
eISSN - 1525-3015
pISSN - 0021-8812
DOI - 10.2527/1997.7582286x
Subject(s) - rothschild , library science , art , political science , computer science , law
Source and Description of Primers. We previously identified a SacI polymorphism by using a pig VCAM1 cDNA probe on Southern blots (VCAM1-1; Helm et al., 1994). This polymorphism was not informative enough to map VCAM1. To develop PCR-based genotyping, we sequenced the 3′ untranslated region of pig VCAM1. Subsequently, a pig VCAM1 cDNA was deposited in Genbank; our data agree completely with that reported by Tsang et al. (Accession: U08351). The PCR primers were designed (forward, 5′-TATCAGCCCTCCATAGTCACAT 3′ and reverse, 5′GAAATTGTTGTCCATGACCTTTAT 3′). Method of Detection. The primers were used to PCR amplify a 193-bp segment (25 mL reactions, 1.5 mM MgCl2, .5 pmol of primer) under the following program: 95°C 4 min; 5 cycles of 94°C 1 min, 48°C 1 min, and 72°C 1 min; then 35 cycles of 90°C 1 min, 48°C 1 min, and 72°C 1 min; and a final 72°C 5-min incubation. The PCR fragments were sequenced to confirm VCAM1 was amplified. Description of Polymorphism. Three VCAM1 alleles were identified based on double strand conformation polymorphisms (DSCP) and heteroduplex analysis of PCR products (see Figure 1). Inheritance Pattern. Most F1 crosses within the PiGMaP gene mapping families were informative for this marker (142 informative meioses). No deviation from expected Mendelian segregation was observed. Frequency. Analysis of 53 unrelated pigs across five breeds (Duroc [17], Landrace [10], Large White [12], Meishan [12], and Wild Boar [2]) shows that the allele frequency in commercial breed type animals is allele A, 6%; allele B, 67%, and allele C, 27%. Allele A was seen only in Landrace (25% frequency) and in Meishan (100%). Chromosomal Location. The VCAM1 was mapped to chromosome 4 with two-point LOD scores ranging from 3.11 to 13.73 for several SSC4 markers. The best multipoint map indicates the gene order (cM distance) for these loci is
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom