Preparation and Expression of M2 Gene Plasmid DNA for Potential use in Influenza A Vaccine Production

nfluenza is an enveloped virus belonging to the orthomyxoviridae family with eight segments of negative single-stranded RNA encoding at least 10 distinct proteins. The virus causes a respiratory disease in human with high economical damages. Vaccination is the most cost-effective method for preventing influenza (1, 2). Although most of the influenza vaccines targeted HA, responsible for receptor binding of the virus, the principal deficiency of these vaccines is their highly variable viral target antigens. The accumulation of point mutations is antigenic drift that leads minor and continuous antigenic changes which makes the adaptation of new virus vaccine a necessity for prevention of new epidemics (3, 4). So, it is necessary to produce new upgraded vaccines to prevent influenza epidemic in humans as suggested by the World Health Organization. On the other hand, pandemic influenza is considered as a global concern, could be initiated by a new influenza subtype attains the ability to spread between humans. Considering low effectiveness of antiinfluenza drugs in reducing symptoms and duration of the disease, which takes too long to prepare a well match vaccine in industrial scale, administration of a universal vaccine encoding conserved but less antigenic proteins is more promising way to control seasonal and even a threatening pandemic Influenza (5, 6). The transmembrane M2 protein is conserved among Influenza A viruses and has potential to be considered as a universal vaccine. It is encoded by a spliced the 7th segment RNA, M gene, which codes also for M1 protein (7, 8). The mature M2 homotetramer protein has pHinducible ion channel activity for uncoating of viral RNP and plays an important role in viral replication (9, 10). It has been shown that antiM2 antibodies are cross-protective among different subtypes, limit virus replication and reduce morbidity and mortality in mice. Although in natural infection the level of these antibodies are very low or even undetectable (11). In the present study, we provided a preliminary preparation of plasmid DNA-based vaccine encoding the conserved M2 against influenza A. The expression of full-length M2 protein was determined in the eukaryotic cells. Human influenza virus A/New Caledonia/20/99(H1N1) was inoculated into the Madin Darby canine kidney (MDCK) cell, provided by the Pasteur Institute of Iran. The cells were trypsinized after 18 hours and suspended in 1X PBS. Total RNA was extracted from the cell pellet using easyRED TM Total RNA was extracted, according to the procedures of iNtRON Biotechnology, South Korea and cDNA synthesis was performed using random hexamer. The M2 cDNA template was amplified by PCR using the specific primers as follow, M2-forward: CTCGAGACCATGAGTCTTCTAACCG and M2-rev: GGATCCTTACTTCAACTCTATGCTGAC. I