z-logo
open-access-imgOpen Access
Cloning and Purification of Bacteriophage K11 RNA Polymerase
Author(s) -
Minqing Rong,
Ray Castagna,
William T. McAllister
Publication year - 1999
Publication title -
biotechniques
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.617
H-Index - 131
eISSN - 1940-9818
pISSN - 0736-6205
DOI - 10.2144/99274bm13
Subject(s) - cloning (programming) , bacteriophage , polymerase , biology , rna polymerase , polymerase chain reaction , virology , microbiology and biotechnology , molecular cloning , rna , genetics , dna , gene , escherichia coli , complementary dna , computer science , programming language
Bacteriophage T7 is the prototype of a group of bacterial viruses that each encode a single subunit DNA-dependent RNA polymerase (RNAP). Other members of this class include the coliphages T3 and BA14, the Salmonella phage SP6, the Pseudomonas phage gh1 and the Klebsiella phage K11 (9,16). The phage RNA polymerases have proven to be useful in a variety of applications, including large-scale RNA synthesis, nucleic acid amplification and as the basis for efficient expression systems in both prokaryotic and eukaryotic cells (5,7,8,15,23,24, 26). To facilitate these applications, the T7, T3 and SP6 RNA polymerases have been cloned (2,11,12,17,24) and more recently have been expressed as histidine-tagged fusion proteins, which greatly simplifies their purification (1,6,10). In this work, we describe the expression and purification of a histidinetagged form of the RNA polymerase encoded by bacteriophage K11. The availability of K11 RNAP furnishes opportunities for additional expression and transcription systems and also provides a useful molecular reagent for comparative analysis of this class of enzymes. Bacteriophage K11 and the host bacterial strain Klebsiella pneumoniae were obtained from the laboratory of Rudolph Hausmann (Freiburg, Germany) via Ian Molineux (University of Texas, Austin, TX, USA). The phages were propagated and harvested by differential centrifugation as previously described for bacteriophage T7 (22), and DNA was isolated from the phage particles by phenol extraction (21). The K11 RNAP gene was amplified from phage DNA by polymerase chain reaction (PCR) using Pfu DNA Polymerase (Stratagene, La Jolla, CA, USA) and the primers MR113 (CCGCTCGAGATGAACGCATTAAACATTGG) and MR114 (CGGAATTCTTACGCAAACGCGAAGTCAGA). These Benchmarks

The content you want is available to Zendy users.

Already have an account? Click here to sign in.
Having issues? You can contact us here
Accelerating Research

Address

John Eccles House
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom