Promoterless Luciferase Reporter Gene Is Transactivated by Basic Helix-Loop-Helix Transcription Factors
Author(s) -
Seok Jong Hong,
Han Chae,
Kwang Soo Kim
Publication year - 2002
Publication title -
biotechniques
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.617
H-Index - 131
eISSN - 1940-9818
pISSN - 0736-6205
DOI - 10.2144/02336bm11
Subject(s) - luciferase , transcription factor , genetics , transcription (linguistics) , reporter gene , gene , microbiology and biotechnology , biology , gene expression , transfection , philosophy , linguistics
Diverse reporter gene systems are widely used for the mapping and functional analysis of the promoter sequences that critically control the cell typeand stimulus-specific transcriptional activity of diverse eukaryotic genes. In this type of analysis, the promoters are fused to the reporter genes, whose activity can be easily and stably assayed following transient transfection, to evaluate the promoter function. In addition, reporter gene systems are indispensable for functional characterization of trans-acting transcription factors and/or effectors of diverse signaling pathways, which can directly or indirectly regulate the promoter activity. One of the most frequently used reporter genes is bacterial chloramphenicol acetyltransferase (cat) because it is not intrinsically expressed in higher eukaryotic cells (1). More recently, the luciferase gene cloned from the firefly Photinus pyralis has become increasingly popular, largely because of its higher sensitivity and efficient nonradioactive assay system (1). For example, for the year 2001, more than 1200 papers have reported promoter studies using the luciferase reporter system, while less than 300 papers were published using the CAT system. Whichever reporter system is used, it is generally assumed that the reporter gene itself and/or the attached sequences [e.g., those encoding the poly(A) signal] do not affect the promoter function. However, this is a scientifically unwarranted assumption and, if it does in certain situations, may significantly confound the functional analysis of the specific promoter. Indeed, we found that the reporter luciferase gene and/or its attached sequences are responsive to the basic helix-loop-helix (bHLH) transcription factors Hand1 and Hand2, as described below. Bone morphogenic proteins are critical signaling molecules for the development of noradrenergic neurons (8,10). Recent studies demonstrated that the homeodomain transcription factor Phox2a is essential for development of noradrenergic neurons (2). In addition, our transient transfection analyses strongly suggested that Phox2a directly controls transcription of the noradrenaline-synthesizing dopamine β-hydroxylase (6,9,11). To understand the regulatory cascade of noradrenergic neuron differentiation and phenotype specification in greater detail, we set out to examine which transcription factor(s) may regulate the promoter of the Phox2a gene. In particular, we speculated that the bHLH transcription factors Hand1 (eHand) and Hand2 (dHand) may regulate the Phox2a promoter activity, because (i) they are downstream genes of bone morphogenic protein signals and (ii) ectopic expression of Hand2-induced noradrenergic cell differentiation and Phox2a/2b expression in avian neural crest cell culture (4,5). Hand1 and Hand2 expression plasmids were made as follows. The full-length coding fragment of each gene was generated by RT-PCR from SK-N-BE(2)C mRNA using primer 5′-CGTAGGGATCCGCCATGAACCTCGTGGGCAGCTACGC-3′ (underline is BamHI) and 5′AAGCACTCGAGTCACTGGTTTAA CTCCAGCGCCCA-3′ (underline is XhoI), and 5′-CGTAGGGATCCGCCATGAGTCTGGTAGGTGGTTTTCC-3′ and 5′-AAGCACTCGAGTCACTGCTTGAGCTCCA-GGGCCCA-3′ digested with BamHI and XhoI, and subcloned into the pcDNA3.1/Zeo, resulting in pcDNA/Hand1 and pcDNA/ Hand2, respectively. Coding sequences of Hand 1 and 2 were sequenced, and those clones without any mutation were selected for use. We next co-transfected pcDNA/Hand1 or pcDNA/Hand2 with 1.3hPhox2aLUC, which contains the 1.3-kb upstream sequences of the human Phox2a gene (3) to HeLa cells using the calcium phosphate co-precipitation method, as previously described (3,6). As shown in Figure 1, our results show that Hand1 prominently increased luciferase gene expression driven by 1.3hPhox2aLUC (approximately 4-fold). Notably, we observed that Hand1 modestly (approximately 2fold) increased reporter expression driven by the promoterless construct pGL3-basic (Figure 2A). To identify sequence elements that may respond to Hand1, we generated several hPhox2aluciferase constructs that contain different lengths of the Phox2a gene promoter. Our transfection assays showed that reporter expression driven by 515hPhox2aLUC or 246hPhox2aLUC was similarly activated by Hand1 (data not shown). Interestingly, reporter exBenchmarks
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom