Open AccessCell-Targeted Phagemid Particles Preparation Using Escherichia Coli Bearing Ligand-pIII Encoding Helper Phage Genome
Author(s) -
Zonghai Li,
Hua Jiang,
Jie Zhang,
Jianren Gu
Publication year - 2006
Publication title -
biotechniques
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 0.617
H-Index - 131
eISSN - 1940-9818
pISSN - 0736-6205
DOI - 10.2144/000112294
Subject(s) - phagemid , escherichia coli , genome , biology , bacteriophage , ligand (biochemistry) , phage display , microbiology and biotechnology , computational biology , virology , genetics , gene , receptor , antibody
using primers M13EGF-1: 5′-CGGG TAC C T T T C TAT T C T C AC T C TA ATTCCGACTCTGAATGCCC -3′ and M13EGF-2: 5′-GTTTCGGC GAACCTCCACCACGCAGTTCCC ACCATTTC-3′, thus generating DNA fragment 1. The DNA fragment 2 was amplified from M13KO7 using primers CT-1: 5′-CTGCGTGGTGG AGGTTCGGCTAGCGGTGGTGGCT
Accelerating Research
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom
Address
John Eccles HouseRobert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom