English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Plus monthly

Global: Zendy Tools annual

Global: Zendy Tools monthly

Global: Zendy Free Plan

using primers M13EGF-1: 5′-CGGG TAC C T T T C TAT T C T C AC T C TA ATTCCGACTCTGAATGCCC -3′ and M13EGF-2: 5′-GTTTCGGC GAACCTCCACCACGCAGTTCCC ACCATTTC-3′, thus generating DNA fragment 1. The DNA fragment 2 was amplified from M13KO7 using primers CT-1: 5′-CTGCGTGGTGG AGGTTCGGCTAGCGGTGGTGGCT

Cell-targeted phagemid particles preparation using Escherichia coli bearing ligand-pIII encoding helper phage genome