
An immunostimulatory DNA sequence from a probiotic strain of Bifidobacterium longum inhibits IgE production in vitro
Author(s) -
Takahashi Noritoshi,
Kitazawa Haruki,
Shimosato Takeshi,
Iwabuchi Noriyuki,
Xiao Jinzhong,
Iwatsuki Keiji,
Kokubo Sadayuki,
Saito Tadao
Publication year - 2006
Publication title -
fems immunology & medical microbiology
Language(s) - English
Resource type - Journals
eISSN - 1574-695X
pISSN - 0928-8244
DOI - 10.1111/j.1574-695x.2006.00064.x
Subject(s) - bifidobacterium longum , biology , immunoglobulin e , immune system , ovalbumin , probiotic , microbiology and biotechnology , in vitro , bifidobacterium , antibody , immunology , biochemistry , bacteria , lactobacillus , fermentation , genetics
The immunostimulatory oligodeoxynucleotide (ODN) BL07 (5′‐GCGTCGGTTTCGGTGCTCAC‐3′) was identified from the genomic DNA of the probiotic strain Bifidobacterium longum BB536. ODN BL07 stimulated B‐lymphocyte proliferation and induced interleukin‐12 (IL‐12) production in macrophage‐like J774.1 cells. ODNs BL07 and BL07S (modified with phosphorothioate backbone) significantly inhibited immunoglobulin E (IgE) production and stimulated interferon‐γ (IFN‐γ) and IL‐12 production, but did not affect IL‐4 secretion in murine splenic cells of ovalbumin‐primed BALB/c mice. These ODNs also significantly inhibited production of IgE in purified murine B cells in the presence of IL‐4 and anti‐CD40. The results suggest the potential of ODNs BL07 and BL07S in preventing IgE‐related immune responses and the possible involvement of ODN BL07 in the antiallergic efficacy of B. longum BB536.