Open AccessCrystallization and preliminary X‐ray diffraction analysis of a self‐complementary DNA heptacosamer with a 20‐base‐pair duplex flanked by seven‐nucleotide overhangs at the 3′‐terminus
Author(s) -
Yeo Hyun Koo,
Lee Jae Young
Publication year - 2010
Publication title -
acta crystallographica section f
Language(s) - English
Resource type - Journals
ISSN - 1744-3091
DOI - 10.1107/s1744309110010687
Subject(s) - crystallization , duplex (building) , crystallography , base pair , dna , nucleotide , base (topology) , diffraction , x ray crystallography , materials science , chemistry , physics , biochemistry , optics , gene , mathematics , organic chemistry , mathematical analysis
The self‐complementary DNA heptacosamer (a 27‐mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20‐base‐pair duplex flanked by seven‐nucleotide overhangs at the 3′‐terminus. Crystals of the oligonucleotide were obtained by sitting‐drop vapour diffusion and diffracted to 2.8 Å resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit‐cell parameters a = 48.74, b = 64.23, c = 79.34 Å, α = 91.37, β = 93.21, γ = 92.35°.