Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana | Zendy

David E. Somers | Zendy; Timothy Caspar | Zendy; Peter H. Quail | Zendy

AI Assistant Blog Pricing

Home ZAIA Blog

Open Access

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

Author(s) -

David E. Somers,

Timothy Caspar,

Peter H. Quail

Publication year - 1990

Publication title -

plant physiology

Language(s) - English

Resource type - Journals

SCImago Journal Rank - 3.554

H-Index - 312

eISSN - 1532-2548

pISSN - 0032-0889

DOI - 10.1104/pp.93.2.572

Subject(s) - ferredoxin , biology , arabidopsis thaliana , gene , arabidopsis , genetics , sequence analysis , intron , open reading frame , peptide sequence , microbiology and biotechnology , biochemistry , mutant , enzyme

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.

The content you want is available to Zendy users.

Already have an account? Click here to sign in.

Having issues? You can contact us here

Accelerating Research