The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum | Zendy

Hiroshi Hori | Zendy; Syozo Osawa | Zendy; Masaki Iwabuchi | Zendy

AI Assistant Blog Pricing

Home ZAIA Blog

Open Access

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum

Author(s) -

Hiroshi Hori,

Syozo Osawa,

Masaki Iwabuchi

Publication year - 1980

Publication title -

nucleic acids research

Language(s) - English

Resource type - Journals

SCImago Journal Rank - 9.008

H-Index - 537

eISSN - 1362-4954

pISSN - 0305-1048

DOI - 10.1093/nar/8.23.5535

Subject(s) - dictyostelium discoideum , slime mold , biology , mycetozoa , nucleic acid sequence , dictyostelium , sequence (biology) , nucleotide , genetics , ribosomal rna , microbiology and biotechnology , dna , gene

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

The content you want is available to Zendy users.

Already have an account? Click here to sign in.

Having issues? You can contact us here

Accelerating Research