z-logo
open-access-imgOpen Access
Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter
Author(s) -
Huiping Shi
Publication year - 1999
Publication title -
nucleic acids research
Language(s) - English
Resource type - Journals
SCImago Journal Rank - 9.008
H-Index - 537
eISSN - 1362-4954
pISSN - 0305-1048
DOI - 10.1093/nar/27.24.4807
Subject(s) - biology , caat box , microbiology and biotechnology , tata box , gene , complementary dna , exon , cdna library , intron , promoter , reporter gene , rapid amplification of cdna ends , gene expression , genetics , molecular cloning
The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

The content you want is available to Zendy users.

Already have an account? Click here to sign in.
Having issues? You can contact us here
Accelerating Research

Address

John Eccles House
Robert Robinson Avenue,
Oxford Science Park, Oxford
OX4 4GP, United Kingdom