English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

The complete nucleotide sequence of the 1525 bp 16S ribosomal RNA gene from the rrnE operon of Streptomyces griseus subsp. griseus KCTC9080 was determined (1). The 5' and 3' ends of the 16S rRNA were located with the combination of previous data (2, 3, 4) and have not been determined experimentally. The nucleotide sequence presented here was determined following the dideoxy method (5) and using M13 universal as well as 16S rRNA specific synthetic oligonucleotide primers. The 16S RNA sequence determined here showed homology values of 96.2% with S. coelicolor (2), 96.4% with S. lividans (3) and 96.1 % with S. ambofaciens (4). It is notable that the homology values among other three reference sequences are more than 98%. Figure 1 shows the alignment of highly variable regions (from 171 to 199 nt in our numbering). This region may be valuable for the rapid identification and grouping of Streptomyces species. Figure 2 shows a phylogenetic tree constructed based on the sequence alignment and Knuc values (6). Although the limited number of complete 16S rRNA sequences determined in the genus Streptomyces makes it impossible to ascertain the position of this species, it is certain that S. griseus subsp. griseus comprises a unique branch. S. lividans (2) and S. coelicolor (3) is more closely related with each other than other organisms. (a) (b) (c) (d) CTGATCCGCTTGGGCATCCAGGCGGTTCG -AC..T..GT.CC....GG.ACG..G.TA

Complete nucleotide sequence of a 16S ribosomal RNA gene fromStreptomyces griseus subsp. griseus