Expansion of the germline analysis for the INHA gene in Indian women with ovarian failure

Expansion of the germline analysis for the INHA gene in Indian women with ovarian failure Sir, Previously we had reported mutational analysis of the mature peptide region of inhibin genes (INHA, INHBA and INHBB) in Indian women with ovarian failure (Dixit et al., 2004). This article has reported a significant association of the c.769G>A (p.Ala257Thr) missense variant in INHA gene (inhibin alpha) in Indian women with ovarian failure. Our article demonstrated the presence of this variant in 11.2% cases of premature ovarian failure (POF) and 9.1% cases of primary amenorrhoea (PA) with their complete absence in controls. This published article described a case–control study based on the 80 cases of POF, 33 cases of PA and 100 controls. The potential importance of this variant encouraged us to further analyse the germline status of the complete coding region of INHA gene with an increased population size. The other two inhibin genes INHBA and INHBB were not found to be associated with ovarian failure and hence were not considered for further analysis. This letter reports an enhanced mutational analysis of the complete coding region of INHA gene in 133 cases of POF, 63 cases of PA and 200 controls including the previously reported individuals. Our published article described the sequence analysis of only second half of the second exon, which codes for the mature peptide region. This letter additionally introduces the sequence analysis of the first exon and first half of the second exon covering the signal peptide as well as the proregion. The first exon was amplified using INHAEX1F (5′GTCGCTTGAGGCGAAATCC3′) and INHAEX1R (5′GTCTCCCAGCGCATACTTC3′) primers. The first half of the second exon was amplified using INHAEX2AF (5′CCGGAGGGCGTGGAGCAGAGT3′) and INHAEX2AR (5′GGCGCAGAGCAGAGGGAGACCAA3′) primers. The second half of the second exon (mature peptide region) was amplified as mentioned earlier (Shelling et al., 2000). The updated prevalence of c.769G>A variant is 10.5% of cases of POF (14 out of 133, Fisher's exact test, P = 0.000017), 10% of cases of PA (six out of 60, Fisher's exact test, P = 0.0007), with its presence in one out of 200 controls. All the mutant individuals were heterozygous except one homozygous, which was identified in our published article. The earlier reported SNP c.1–124A>G (rs11893842) was revealed with the geno-SNP represented almost similar genotypic distribution among the patient and control population. The earlier reported variant c.1–16C>T (mentioned as 129C>T by Montgomery et al., 2000; Marozzi et al., 2002) was …