An ATF/CREB binding site protein is required for virus induction of the human interferon β gene

We report the characterization of a distinct regulatory element of the human interferon (3 (HuIFN-(3) gene promoter, which we designate PRDIV (positive regulatory domain IV). In previous studies, sequences between -104 and -91 base pairs upstream from the start site of transcription were shown to be required for maximal levels of virus induction in mouse L929 cells. We have localized the essential sequence in this region extending from -99 to at least -91, and we show that this sequence is a binding site for a protein of the activating transcription factor/cAMP response element binding protein (ATF/CREB) family of transcription factors. Mutations in PRDIV that decrease the affinity of one member of this family (ATF-2/CRE-BP1) decrease the level of virus induction in vivo. Moreover, multiple copies ofPRDIV can confer both virus and cAMP inducibility upon a minimal promoter in L929 cells, while it is constitutively active in HeLa cells. We conclude that PRDIV is a distinct regulatory element of the HuIUFN-f promoter and that the signal transduction pathways involved in virus and cAMP induction may partially overlap. Expression of the human interferon p (HuIFN-f8) gene is highly inducible by both virus and double-stranded RNA (1). Studies of the sequence requirements for induction revealed cell type-specific differences (2). Specifically, only 77 base pairs (bp) of promoter sequences upstream from the transcription start site is required for virus induction in mouse C127 cells, while 104 bp is required in mouse L929 cells (3-6). As shown in Fig. 1, two distinct virus-inducible elements were identified in the -77 promoter. The positive regulatory domain I (PRDI) is located between nucleotides -77 and -64 from the start site of transcription, while another element (PRDII) is located between -66 and -55 (7-10). A third element (PRDIII) is located between -90 and -78 (11-15). The -104 and -91 region ofthe HuIFN-pB promoter, which we designated PRDIV, is essential for high levels of virus induction in mouse L929 cells (5, 6). Comparison of the DNA sequence in this region with known protein binding sites reveals three potential regulatory sequences (see Fig. 1). First, a potential IRF-i-like binding site is located between -103 and -91 (16, 17). Second, an Oct-i site (18) is located between -105 and -98. This site was previously shown to specifically bind to the Oct-i protein in vitro (A. Keller and T.M., unpublished data). Third, an ATF-CREB site is located between -99 and -91. This ATF/CREB site fits with the consensus 5'-GTGACaTA/CA/G-3' except at position -94 (underlined), which has an A instead of a G (19, 20). We find that recombinant ATF/2CRE-BP1 protein produced in bacteria (21, 22) binds specifically to this site (unpublished data). To determine which of the three potential regulatory elements in PRDIV is required for virus induction in L929 and HeLa cells, we introduced point mutations into this region and then tested their effect on virus induction in transient transfection assays. We found that the ATF/CREB site, but not the IRF-1-like site or the Oct motif, is required for virus induction in both L929 and HeLa cells. In addition, we found that multiple copies of PRDIV are able to confer both virus and cAMP induction in L929 cells but are constitutively active in HeLa cells. Thus, PRDIV is a distinct regulatory element required for maximal levels of virus induction of the HuIFN-P gene. These observations suggest that the regulatory pathways involved in virus and cAMP induction may partially overlap. MATERIALS AND METHODS Oigonucleodes. MT-a, 5'-GATCTCTCTCTATTCAGAGGAATTTCCCACTTTCACTTCTCCCTTTCAGTTTTCCTATGTCXYYYXZXYTTTAGG-3' (75-mer); MT-s, 5'GATCCCTAAAXYQYXXXYGACATAGGAAAACTGAAAGGGAGAAGTGAAAGTGGGAAATTCCTCTGAATAGAGAGA-3' (75-mer) (X is 90%o A + 3.33% each G + C + T, Y is 90%oT + 3.33% each G + C + A, Z is 90o C + 3.33% each A + T + G, and Q is 90%oG + 3.33% each A + T + C); MTCRE, 5'-CGGGATCCTAAAATGTAAAT(G,T)(A,C) C(A,G)TAGGAA-3' (30-mer); RES, 5'-GACTCTAGAGGATCTGAATTCCATGACATAGGAAAACTGAAA-3' (42mer); MTPRDIII, 5'-AGAGGATCCTAAAATGTAAATGACATAG(G,T)(A,C)(A,G)(A,C)CTG-3' (36-mer); PRDIV-s, 5'GATCCTGTAAATGACATAGGAAAA-3' (24-mer); PRDIV-a, 5'-GATCYTTfCCTATGTCATTTACAG-3' (24mer); CRE, 5'-AATTCTGACGTCAG-3' (14-mer). Mutagenesis. Mutants in the Oct motif were made by clone annealed MT-a/MT-s oligonucleotides into a -40 IFN chloramphenicol acetyltransferase (CAT) construct linearized with BamHI. Mutants in the ATF/CREB site and PRDIII were made by PCR, using HindIII linearized WT-1 from Fig. 2 as template and SP6 and MTCRE or MTPRDIII as primer. PCR products were digested with BamHI and Cla I, and cloned into -40 HulFN-3 CAT digested withBamHI and Cla I. The -99 IFN CAT constructs were made as described above, except the HindIII linearized -91 IFN CAT was used as a template, and SP6 and RES were used as primers. Cloning procedures were as described (23). Cell Culture, DNA Transfection, CAT Assay, and RNase Mapping. Cells were maintained as described (7). Transfections were done by either the DEAE-dextran (24) or the calcium phosphate (25) method. The calcium phosphate method is used unless otherwise indicated. Cells were induced with virus (3) or 1 mM 8-bromo-cAMP, or they were mock induced. CAT assay and RNase mapping were done as described (7). All the data shown have been repeated at least three times. Abbreviations: HuIFN-p, human interferon 8; PRD, positive regulatory domain; IRF-1, interferon regulatory factor 1; ATF/CREBP, activating transcription factor/cAMP response element binding protein; CAT, chloramphenicol acetyltransferase; CHX, cycloheximide. 2150 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Proc. Natl. Acad. Sci. USA 89 (1992) 2151