English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Zendy Plus

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Zendy Tools

Zendy Open

I have analyzed the occurrence of alternating pyrlmldine-purine (Py-Pu) runs longer than 8 nucleotldes in the DNA sequences of staphylococcal tetracyclineresistance plasmid pNSI (3879 bp)(1) and pT181 (4437 bp)(2). The sequence of pNSI matches that of a plasmid which was generated by deletion of the smallest tfindlll fragment (0.6 kbp) from pT181, with the exception of 18 nucleotides. pNSl(») and pT181(O) were found to have a total of 13 and 12 of the following Py-Pu runs, respectively:lACGCACATACTGTGTGCATATl (>O) . TGCATATATGT(•<? , GTGTACATAT(«O), GCACACGTAT(J»O), ATATGCGTAT(»O) , TATATGCA(»O) , GTATGCAC(»O), ACATGCAT^O), GTATGTAC («O) , ATATACAT(«O) , TATGTATA(»O) , CACATATGCAT(«) , ATACACATG(•), ATACACATA(O). These sequences are for the mRNA strand. The most noticeable run (boxed) is the 21 nucleotides long consisting of two consecutive stretches of 10 and 11 nucleotides, with interruption at the middle of the sequence. It (with two heavy lines in the figure) is located in the replication origins of pT181 and pNSI (between the two marks (•)), which are contained within the coding sequence for the initiator protein of plasmid replication (Rep). Koepsel et al. (3) have reported that highly purified Rep protein of pT181 (Rep C) introduces a single-strand break (^) within its replication origin. The nucleotide sequence around the cleavage site can potentially form a hairpin structure with the nick site occurring with the unpaired loop. Of interest is the fact that the hairpin structure (the nick site) is continuous with the noticeable Py-Pu run with 21 nucleotides. There is the possibility that it plays some role in the initiation of plasmid replication. [This work was supported in part by Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan].

An occurrence of a noticeable alternating pyrimidine-purine run in the replication origins of tetracycline-resistance plasmids pNSI and pT181