English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Plus monthly

Global: Zendy Tools annual

Global: Zendy Tools monthly

Global: Zendy Free Plan

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

The nucleotide sequence of chloroplast 4.5S rRNA from a fern,Dryopteris acuminata