English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are keytranscription factors in animal growth and reproduction. Insertion/deletion(indel) is a relatively simple and effective DNA marker. Therefore, four sheepbreeds of various fecundity were used to explore the novel indel variantswithin the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growthtraits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheepLHX3 gene was found, and three genotypes were detected. Interestingly, theincreasing trends of II (insertion/insertion) genotype frequency and Iallelic frequency were the same as the growth of the fertility character. Genotypicfrequency and allelic frequency distributions were significantly differentbetween the high-fecundity breeds (HS, STHS and LFTS) and low-fecunditybreed (TS) based on a χ2 test (P < 0.05). Associationanalyses showed that body length was significantly different in female TSand STHS and that chest width was significantly different for the female TS andmale STHS (P < 0.05). These findings suggested that the 29 bp indelcould extend the spectrum of genetic variations of the LHX3 gene in sheep andprovide a valuable theoretical basis for the marker-assisted selection (MAS)in sheep breeding and genetics

archives animal breeding/archiv für tierzucht

A novel 29 bp insertion/deletion (indel) variant of the &amp;lt;i&amp;gt;LHX3&amp;lt;/i&amp;gt; gene and its influence on growth traits in four sheep breeds of various fecundity