English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

Chondrocyte apoptosis, known as programmed cell death, as a normal physiological phenomenon is responsible for modulating the homeostasis of articular cartilage, while excessive apoptosis of chondrocytes is a central pathological incident in articular cartilage injury or osteoarthritis (OA) [1, 2]. A substantial body of evidence reveals that mechanical overShi-cheng Xie, Lin Yang, Taipengfei Shu, Qin Liu, Wenbo Wang 2 Arch Med Sci load and inflammatory cytokines are the primary factors contributing to cartilage degradation and chondrocyte apoptosis [3, 4]. Investigation into the molecular mechanisms of apoptosis of chondrocytes has revealed multiple signaling pathways, including tumor necrosis factor-α (TNF-α)/TNF receptors (TNFR), caspase, Fas/FasL, p53 and myc, participating in this pathological process [5–9]. TNF receptor superfamily member 1A-associated death domain (TRADD), as a novel 34-kDa protein, specifically interacts with TNFR to activate apoptosis or necroptosis via nuclear factor-κB (NF-κB) activation and caspase-8 (casp-8)/casp-3 [10]. Over-activation of TRADD signaling is implicated in TNF-α-induced apoptosis and necrosis in many cells, including osteoclasts, neuronal cells, keratinocytes and Jurkat T cells [10–13]. Moreover, up-regulation of TRADD mRNA or protein expression is involved in ofloxacinor interleukin-1β-induced apoptosis of chondrocytes [5, 14]. However, the roles of TRADD in TNF-α-caused chondrocyte apoptosis are still unclear. MicroRNAs (miRNAs) have been validated as a  novel class of small non-coding RNAs with the length of 18-25 nucleotides, which are implicated in expression regulation of more than one-third of human genes via post-transcriptional repression [15, 16]. Numerous studies indicate that miRNAs participate in a variety of biological processes, such as proliferation, differentiation and apoptosis [17, 18]. In addition, miRNAs have also been demonstrated to modulate disease progression, including cancer, diabetes mellitus, cardiovascular diseases, acute gouty arthritis and OA [18–20]. Several differentially expressed miRNAs have been identified to be related to chondrocyte apoptosis [21, 22]. However, the exact etiological mechanism of miRNA in the pathogenesis of TNF-α-induced chondrocyte apoptosis is not clear. In the present study, we aimed to explore whether TRADD-specific miRNAs participate in the regulation of chondrocyte apoptosis. The results demonstrated that a  total of 13 miRNAs were filtered by both TargetScan and miRDB. Among these miRNAs, we found that miR-149-5p as a candidate miRNA was significantly repressed in TNF-α-stimulated chondrocyte. Furthermore, miR-149-5p mimics were transfected into chondrocytes to investigate the effect of miR-149-5p gain-of-function in TNF-α-induced chondrocyte apoptosis in vitro. Material and methods Cell culture Human primary chondrocytes were obtained as described previously [2] and were cultured in DMEM-F12 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 5% CO 2 and 95% air as described previously [2]. Cell counting kit 8 (CCK8) assay Cell viability was detected using a  CCK-8 kit (Beyotime Institute of Biotechnology, Haimen, China). Absorbance was recorded at 450 nm. Enzyme linked immunosorbent assay (ELISA) The levels of IL-1β (Cat. no: E-EL-H0149c), IL-6 (Cat. no: E-EL-H0102c) and IL-18 (Cat. no: E-ELH0253c) in the supernatant of cultured chondrocytes were measured using ELISA kits (Elabscience Biotechnology Co., Ltd, Wuhan, China) as described previously [23]. Annexin V-FITC double staining for apoptosis analysis Annexin V-FITC kit (BD Biosciences, Franklin Lakes, NJ, USA) was used to evaluate the apoptotic cell proportion as described previously [23]. miR prediction The bioinformatics algorithm was executed by TargetScan (www.targetscan.org) and miRDB (www. mirdb.org) to predict the potential miRNAs which could target modulation of TRADD expression via binding with its 3′-untranslated regions (3′-UTRs). Cell transfection and plasmid constructs miR-control (miR-Con; 5′-UACUUAGUCCGGGAGUCCCAGUC-3′) and miR-149-5p mimics (5′-UCUGGCUCCGUGUCUUCACUCCC-3′) were synthesized by Guangzhou RiboBio Co., Ltd. (Guangzhou, China) and were transfected into chondrocytes using Lipofectamine 2000 (Invitrogen) as described previously [24]. A mammalian expression plasmid designed to specially express the full-length open reading frame of human TRADD without 3′-UTR, which did not contain the conserved complementary sequence binding with miR-149-5p, was purchased from GeneCopoeia, Inc. (Rockville, MD, USA). An empty plasmid served as the negative control. Vector-Con and vector-TRADD were transfected into chondrocytes using Lipofectamine 2000 (Invitrogen) as described previously [24]. Luciferase reporter assay The wild-type (WT) or mutant-type (Mut) 3′UTR of TRADD was inserted into the multiple cloning sites of the luciferase expressing pMIRREPORT vector (Ambion; Thermo Fisher Scientific, Inc.). For the luciferase assay, chondrocytes containing the WT or Mut 3′-UTR of TRADD (0.5 μg) were co-transfected with miR-Con or miR-149-5p mimics using Lipofectamine 2000, according to the manufacturer’s protocols. The luciferase activmiR-149-5p mitigates tumor necrosis factor-α-induced chondrocyte apoptosis by inhibiting TRADD Arch Med Sci 3 ity was measured using a luciferase reporter assay kit (Promega Corporation, Madison, WI, USA) according to the manufacturer’s protocols. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) miRNeasy Mini Kit (Qiagen, Inc., Valencia, CA, USA) was used to extract total RNA. TaqMan RT kit and TaqMan MicroRNA assay (Applied Biosystems) were used to detect miRNA expression levels using the Applied Biosystems 7300 Real-Time PCR system, according to the manufacturer’s protocol. U6 small nuclear RNA was used as an endogenous control. The relative expression levels of miRNAs were calculated using the 2-ΔΔCq method [25]. The primers of miRs for qPCR are shown in Table I. Western blotting Western blotting were performed as previously described [26]. Membranes were cultured with primary antibodies of TNFR1 (Cat. no: sc-8436; dilution: 1 : 1,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), TRADD (Cat. no: sc-46653; dilution: 1 : 1,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), cleaved caspase-3 (Cat. no: 9661; dilution: 1 : 1,000; Cell Signaling Technology, Beverly, MA, USA) and cleaved caspase-8 (Cat. no: 9748; dilution: 1 : 1,000; Cell Signaling Technology, Beverly, MA, USA) at room temperature for 2 h. Then the membranes were incubated with an appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) at room temperature for 2 h and visualized with an enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.). Signals were analyzed with Quantity One software version 4.5 (Bio Rad Laboratories, Inc., Hercules, CA, USA). Anti-β-actin (Cat. no: sc-47778; dilution: 1 : 2,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) was used as the control antibody. Ethics The present study was approved by the First Affiliated Hospital of Harbin Medical University (Harbin, China). Statistical analysis Data were presented as the mean ± standard error of the mean. Statistical analysis was performed using SPSS software version 19.0 (IBM Corp., Armonk, NY, USA) and GraphPad Prism Version 7.0 (GraphPad Software, Inc., La Jolla, CA, USA). Student’s t-test was used to analyze the differences between the two groups. Differences between multiple groups were analyzed by one-way analysis of variance, followed by a post-hoc Tukey test. P < 0.05 was considered to indicate a statistically significant difference. Results TNF-α inhibited chondrocyte growth and elevated the production of inflammatory cytokines and apoptotic cell proportion Chondrocytes were exposed to TNF-α for various durations at different concentrations, the CCK8 Table I. miRs primers for RT-qPCR Gene Forward primer (5′–3′) Reverse primer (5′–3′) miR-4530 ATCAGGACGGGAGCGAAAA CAGTGCGTGTCGTGGAGT miR-6852-5p GCGTGGGGTTCTGAG GTGCAGGGTCCGAGGT miR-149-5p GGCTCTGGCTCCGTGTCTT CAGTGCAGGGT CCGAGGTATT miR-515-5p CGGGTTCTCCAAAAGAAAGCA CAGCCACAAAAGAGCACAAT miR-519e-5p GCGCTTCTCCAAAAGGGAG CAGTGCGTGTCGTGGAGT miR-4433a-5p GCGCCGTCCCAAC CAGTGCGTGTCGTGGAGT miR-4804-3p GCGCTGCTTAACCTTGCCC CAGTGCGTGTCGTGGAGT miR-6840-3p GCGCGCCCAGGACTTTGTGC CAGTGCGTGTCGTGGAGT miR-1827 GGGGTGAGGCAGTAGATTG CAGTGCGTGTCGTGGAGT miR-3065-3p GCGCTCAGCACCAGGATATTG GTGCAGGGTCCGAGGT miR-4492 CTGGGCGCGCGCCAAA CTCAACTGGTGTCGTGGAGTC miR-432-3p GTGGATGGCTCCTCC GTGCAGGGTCCGAGGTATTC miR-5704 GCGCTTAGGCCATCATCCCA GTGCAGGGTCCGAGGT U6 CTCGCTTCGGCAGCACATATACT GTGCAGGGTCCGAGGT Shi-cheng Xie, Lin Yang, Taipengfei Shu, Qin Liu, Wenbo Wang 4 Arch Med Sci assays demonstrated that TNF-α stimulation led to significant cell growth inhibition in a timeand concentration-dependent manner (Figure 1 A). The 50% inhibition rate of TNF-α on chondrocyte growth occurred after TNF-α treatment at the concentration of 100 ng/ml for 48 h (Figure 1 A). In addition, the levels of inflammatory cytokines, including IL-1β, IL-6 and IL-18, were significantly higher in TNF-α-treated chondrocytes than those of the control group (Figure 1 B). We also found that the apoptotic cell proportion was increased in chondrocytes in the presence of TNF-α treatment (Figure 1 C). Western blotting analysis revealed that cell apoptosis-related signaling pathways, TNFR1/TRADD and caspase-3/8, were activated in TNF-α-treated chondrocytes (Figures 1 D, E). Expression of post-transcriptional regulators-miRNAs miRNAs as post-transcriptional regulators have been reported in the process of chondrocyte apoptosis [3]. However, TRADD-related miRNAs have not been described in TNF-α-induced chondrocyte apoptosis. We used the bioinformatics algorithms TargetScan (www.targetscan.org) and miRDB (www.mirdb.org) to predict TRADD-related miRNAs, and the results showed