English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Plus monthly

Global: Zendy Tools annual

Global: Zendy Tools monthly

Global: Zendy Free Plan

-A PCR method targeting 16S rDNA was used for detecting the causative agent of bacterial hemolytic jaundice in yellowtail Seriola quinqueradiata. A primer set (forward primer: AGCACTTATGTATAGG TGTA; reverse primer: GTATAAAACGCCAAACATAT) amplified a 387bp product, which was specific for this bacterium. Using yellowtail intraperitoneally injected with this bacterium, the PCR product was observed in templates from blood, liver, kidney and spleen, but not from muscle. Blood specimen was expected to be best for diagnosis of the disease by PCR.

PCR-based Detection of the Causative Agent of Bacterial Hemolytic Jaundice in Yellowtail