English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Plus monthly

Global: Zendy Tools annual

Global: Zendy Tools monthly

Global: Zendy Free Plan

mannoproteins in Saccharomyces cerevisiae plays an important role for cell morphogenesis and growth in various stressful conditions (Klis, 1994). The GAS1 and KEX2 genes encode a plasma membrane b-1,3glucanosyltransferase (Mouyna et al., 2000) and a late Golgi processing endoprotease (Rockwell and Fuller, 1998), respectively. Mutants of these genes show significant defects in the cell wall and a double mutant is inviable (Tomishige et al., 2003). To understand the basis of this synthetic lethality, we screened for multicopy suppressors using a kex2D pGAL1::GAS1 strain and synthetic dextrose (SD) medium, and identified 13 SKG (suppressor of kex2 g_as1 synthetic lethality) genes (Tomishige et al., 2005). In this communication, we report that SKG6 encodes a novel membrane protein which shows polarized intracellular localization. The isolated library plasmid containing SKG6 suppressed the synthetic lethality of a kex2D pGAL1:: GAS1 strain on SD medium (Fig. 1). The SKG6 (S. cerevisiae systematic name, YHR149c) DNA was amplified by PCR using primers NT157 (TCTACTGATGGATCCAATTCG), and NT156 (AAGATGCAGACTAGTTCATTG) or NT158 (ATTATCTACTCGAGAGTTGACGGT), and cloned in 2-mm and CEN plasmids, with or without the 3HA tag to detect the gene product, as described in the study of SKG1 (Tomishige et al., 2005). The kex2D pGAL1::GAS1 strain carrying these plasmids formed colonies on SD medium similarly (data not shown). Therefore, a low-copy SKG6 is sufficient for suppression of the synthetic lethality, and the addition of 3HA tag at the C-terminus does not interfere this activity. However, these plasmid had no effect on any phenotype of the kex2D or gas1D single null strain. SKG6 encodes a protein of 734 amino acids. Our database search suggested that the S. cerevisiae TOS2 (systematic name, YGR221c) gene encodes a protein of 622 amino acids which has 35% sequence identity with Skg6 (Fig. 2). The hydropathy plot and the prediction program suggested that both proteins have a single transmembrane domain at the N-terminal region. No significant motifs which suggest their possible functions were found. The lysate of skg6D cells expressing Skg6-3HA was subjected to SDS-PAGE and immunoblot analysis. A major band at 70 kDa and a minor band at 59 kDa were detected (Fig. 3). The band intensity correlated with the copy number of SKG6 and the presence of the minor band was more significant in the 2-mm plasmid carrier. Multiple bands suggest some modification and/or proteolysis occurs. As Skg6 has 13 possible Nglycosylation sites (Asn-X-Ser/Thr, Fig. 2), we examSKG6, a suppressor gene of synthetic lethality of kex2D gas1D mutations, encodes a novel membrane protein showing polarized intracellular localization

journal of general and applied microbiology

SKG6, a suppressor gene of synthetic lethality of kex2.DELTA. gas1.DELTA. mutations, encodes a novel membrane protein showing polarized intracellular localization