English (United Kingdom)

https://curated-unify.zendy.io/wp-json/zendy-region/v1/featured_content/oa?rat=en

https://curated-unify.zendy.io/wp-json/zendy-region/v1/highlighted_journal/

Global: Zendy Plus annual

Presents the access of premium content as premium feature

Premium Content

Presents the keyphrase highlighting as premium feature

Keyphrase Highlighting

Presents the summarisation as premium feature

Summarisation

Insights

Presents the pdf analysis as premium feature

PDF Analysis

Presents the zaia usage as premium feature

ZAIA

Global: Zendy Tools annual

Global: Zendy Free Plan

Global: Zendy Tools monthly

Global: Zendy Plus monthly

Water deficit is a major limiting factor for grass culture in many regions with physiological mechanisms of tolerance not yet well understood. Antioxidant isozymes and hormones may play important roles in plant tolerance to water deficit. This study was designed to investigate antioxidant enzymes, isozymes, abscisic acid (ABA), and indole-3acetic acid (IAA) responses to deficit irrigation in two perennial ryegrass (Lolium perenne L.) cultivars contrasting in drought tolerance. The plants were subjected to well-watered {100% container capacity, 34.4% ± 0.21% volumetric moisture content (VWC), or deficit irrigation [30% evapotranspiration (ET) replacement; 28.6% ± 0.15% to 7.5% ± 0.12% VWC]} conditions for up to 8 days and rewatering for 4 days for recovery in growth chambers. Deficit irrigation increased leaf malondialdehyde (MDA) content in both cultivars, but drought-tolerant Manhattan-5 exhibited lower levels relative to drought-sensitive Silver Dollar. Superoxide dismutase (SOD) activity declined and then increased during water-deficit treatment. ‘Manhattan-5’ had higher SOD activity and greater abundance of SOD1 isozyme than ‘Silver Dollar’ under water deficit. Deficit irrigation increased catalase (CAT) and ascorbate peroxidase (APX) activity in ‘Manhattan-5’, but not in ‘Silver Dollar’. ‘Manhattan-5’ had higher CAT, APX, and peroxidase (POD) activity than ‘Silver Dollar’ during water limitation. Deficit irrigation increased mRNA accumulation of cytosolic cupper/zinc SOD (Cyt Cu/Zn SOD), whereas gene expression of manganese SOD (Mn SOD) and peroxisome APX (pAPX) were not significantly altered in response to deficit irrigation. No differences inCyt Cu/Zn SOD,Mn SOD, and pAPX gene expression were found between the two cultivars under deficit irrigation.Water limitation increased leaf ABA and IAA contents in both cultivars, with Silver Dollar having a higher ABA content than Manhattan-5. Change in ABA level may regulate stomatal opening and oxidative stress, which may trigger antioxidant defense responses. These results indicate that accumulation of antioxidant enzymes and ABA are associated with perennial ryegrass drought tolerance. Activity and isozyme assays of key antioxidant enzymes under soil moisture limitation can be a practical screening approach to improve perennial ryegrass drought tolerance and quality. Water deficit is a major limiting factor for grass culture in many regions. As a consequence of climate change, water deficit may have an increasingly negative impact on grass quality and persistence (Zhang et al., 2012). Plants have developed various physiological defense systems to cope with abiotic stress, such as antioxidant defenses, hormonal regulation, osmotic adjustment, and saturation level of cell membrane lipids (Huang et al., 2014a). Antioxidants and hormones are some of the most important metabolic defenses against drought stress (Zhang et al., 2012). Water deficit may inhibit photosynthesis and cause an energy imbalance so that the energy absorbed through the light-harvesting complex exceeds what can be dissipated or transduced by photosystem II (Zhang and Ervin, 2008). Excess energy may be directed to oxygen (O2) and result in the accumulation of toxic reactive oxygen species (ROS) (Huang et al., 2014a; Zhang and Ervin, 2004). To limit oxidative damage under stress conditions, plants have developed a series of detoxification systems that break down the highly toxic ROS (Wang et al., 2012; Zhang and Kirkham, 1996; Zhang et al., 2012). Superoxide dismutase has been considered as the first line of defense against ROS by dismutating the superoxide anion to hydrogen peroxide (H2O2), which is finely regulated by CAT and an array of PODs localized in almost all compartments of the plant cell, such as APX (Blokhina et al., 2003). Four kinds of SOD have been found in plants depending on their metal cofactor: the copper/zinc type (Cu/Zn SOD), manganese type (MnSOD), the iron type (FeSOD), and the nickel type (NiSOD), which are localized in mitochondria, Received for publication 7 July 2015. Accepted for publication 6 Aug. 2015. Corresponding author. E-mail: xuzhang@vt.edu. 562 J. AMER. SOC. HORT. SCI. 140(6):562–572. 2015. chloroplasts, cytosol, and peroxisomes (Hu et al., 2012). All these isoforms protects cellular molecules from damage caused by ROS. Ascorbate peroxidase detoxifies H2O2 using ascorbate as a substrate and its isoforms are active in chloroplasts, cytosol, peroxisomes, and mitochondria (Mittler et al., 2004). Previous studies have indicated that higher activity levels of antioxidant enzymes may contribute to greater drought tolerance by increasing a plant’s protective capacity against oxidative damage (Lu et al., 2008; Xu et al., 2011; Zhang and Ervin, 2004; Zhang et al., 2012). Water deficit–induced oxidative stress has been reported in perennial ryegrass (Krishnan et al., 2013; Yu et al., 2013), creeping bentgrass [Agrostis stolonifera L. (DaCosta and Huang, 2007; Zhang and Ervin, 2004)], tall fescue [Festuca arundinacea Schreb. (Man et al., 2011; Zhang et al., 2012)], and kentucky bluegrass [Poa pratensis L. (Jiang and Huang, 2001; Xu et al., 2011)]. Krishnan et al. (2013) noted that APX and POD activity increased in response to drought stress in perennial ryegrass. Variations in antioxidant enzyme activities have been associated with differences in drought tolerance of grass cultivars (Man et al., 2011). Although excessive accumulation of ROS results in cellular damage and breakdown of macromolecules, ROS are signaling molecules that trigger various adaptive responses to abiotic and biotic stresses. Some ROS-scavenging enzymes such as SOD and APX are found in multiple subcellular compartments, contributing to the tight regulation of ROS levels in each organelle under stress conditions (Mittler et al., 2004). Thus, changes in the amount of particular isoforms of each antioxidant enzyme can be more important than alterations in the total activity (Mullineaux and Creissen, 1997). Pinhero et al. (1997) have suggested that synthesis of new antioxidant enzyme isoforms could be more beneficial for antioxidant metabolism than enhancement of the activity. The induction of specific isozymes in many plants has been recognized as biomarkers of various environmental stresses (Kim et al., 2007). Limited research has focused on the gene expression patterns in conjunction with the underlying enzyme activity and isozyme alterations in cultivated grasses. Elucidating the association of antioxidant enzyme activity and gene expression in cultivars with contrasting drought tolerance would contribute to an enhanced understanding of molecular mechanisms of antioxidant defense systems for drought tolerance of cultivated grasses. It has been reported that alteration in hormone metabolism is associated with plant tolerance to abiotic stress (Huang et al., 2014a; Man et al., 2011; Zhang et al., 2009). Abscisic acid and IAA are hormones that mediate signaling events involved in plant adaptation to stress and senescence. IAA is the primary auxin in the majority of plant species. There is evidence showing that adaptation to drought stress is accompanied by an increase in IAA content (Krishnan and Merewitz, 2015). ABA plays a regulatory role in controlling stomatal aperture under drought stress (Strivastava, 2002). Rapid ABA accumulation has been observed when plants are subjected to drought, salinity, and extreme temperatures (Xiong et al., 2002). However, the interrelations between the changes in hormone (IAA and ABA) metabolism and the development of adaptation to drought stress in perennial grass species are largely unknown. Furthermore, little has been reported on antioxidant responses in relation to changes in ABA and IAA levels during deficit irrigation and postdrought recovery in perennial ryegrass. Perennial ryegrass is a cool-season species widely used for golf courses, commercial landscapes, and pastures in temperate climates. Drought stress is a major factor limiting the growth and persistence of perennial ryegrass in many regions (Yu et al., 2013). The practice of deficit irrigation can be done so as to maintain acceptable turf quality while conserving irrigation water (Huang et al., 2014a). The mechanisms of drought tolerance associated with antioxidant and hormone metabolism in cool-season perennial grass species Table 1. Real-time polymerase chain reaction primers used for analysis of antioxidant gene expression in two perennial ryegrass cultivars contrasting in drought tolerance. Primer/gene name Sequence (5#-3#) Annealing temp ( C) eIF1A-forward AACTCAACTTGAAGTGTTGGAGTG 55 eIF1A-reverse AGATCTGGTCCTGGAAAGAATATG 55 pAPX-forward CCTGAAAGGTCTGGGTTTGA 55 pAPX-reverse TCCTTGGCATAAAGGTCCAC 55 Cyt Cu/ZnSOD-forward GACACMACAAATGGHTGCAT 50 Cyt Cu/ZnSOD-reverse TCATCBGGATCGGCATGGACAAC 50 MnSOD-forward CAGRGBGCCATCAAGTTCAACG 55 MnSOD-reverse TACTGCAGGTAGTACGCATG 55 eIF1A = eukaryotic initiation factor 4 alpha; pAPX = peroxisome ascorbate peroxidase; Cyt Cu/Zn SOD = cytolic cupper/zinc superoxide dismutase; MnSOD = manganese superoxide dismutase. Table 2. Parameters for analysis of leaf indole-3-acetic acid (IAA), C-labeled IAA, and abscisic acid (ABA) of two perennial ryegrass cultivars contrasting in drought tolerance using liquid chromatography-mass spectrometry. Analyte Retention time (min) Precursor ion Product ion Application Collision energy (V) Mode IAA 3.6 176.1 130.2 Quantitative 12 + 77.2 Qualitative 52 C-labeled IAA 3.6 182.1 136.2 Quantitative 12 + 83.2 Qualitative 52 + ABA 4.2 265.2 247.2 Quantitative 0 + 229.2 Qualitative 4 + J. AMER. SOC. HORT. SCI. 140(6):562–572. 2015. 563 are not well understood. Few studies have reported on drought stress–induced changes in the isoform patterns of antioxidant enzymes and gene expression in cool-season grasses. Understanding the physiological mechanisms of grass responses to deficit irrigation is important for breeders to develop drought-tolera

journal of the american society for horticultural science

Differential Responses of Antioxidants, Abscisic Acid, and Auxin to Deficit Irrigation in Two Perennial Ryegrass Cultivars Contrasting in Drought Tolerance